The DNA of strain 119-2 were extracted according to the extraction kits MO BIO protocol (Roume, Muller et al. 2013) after culturing overnight. The PCR amplification was done using the universal primer 27F and 1492R with the following; volumes of Taq Mixer (12.
5microlitre), Primer1, DNA strain 119-2 (1microlitre) ddH20 (9.5 microlitres) and Primer 2 (1microlitre) totaling 25ML and placed to electrophoresis machine which was performed at 600C, 30V for 30minutes and taken to DNA amplifier (Bio-rad Mexico) for 2hours and 30 minutes. Later, 5microlitre of the samples, 1microlitre of loading buffer, 5microlitre of DNA marker mixed up and apply to the gel placed on the moulders. Finally was visualized under 2% of the agarose gel after electrophoresis at 30V through a UV transilluminator gel imaging system ( Bio-rad segrate, Italy). The 16SrRNA of strain 119-2 was amplified using the universal primers 16SrRNA 27F (5’AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′ AAGGAGGTGATCCAGCCGCA 3′). The identified 16S rDNA gene sequences (1386bp) was also done using BLAST network service at the National Center for Biological information website (www.
ncbi.nim.nih.gov/BLAST). 5.1. Material and methodsThe minimal salt media (MSM) and Luria-Bertani (LB) media are the media used in this study and the content of MSM are KH2PO4 0.
25gram, Na2HP04.2H20 1.9gram, NH4cl 2.5 gram, MgS04.7H20 0.1gram while LB contains yeast extract 2.5 gram, tryptone 5grams and NaCl 5grams (Liu, Xie et al. 2016).
6.2. Phenol degradationThe cultures of the strain 119-2 (1.
5ml) were prepared and carefully adjusted to an optical density at 600nm (OD600) of 0.8 -1.0, then centrifuge at 10,000 x g for 10 minutes. The supernatant was discarded and washed out the precipitate with saline and inoculated into the flask containing MSM media with 2mM phenol. The different concentration of phenol was increased from two (2) to 12mM which were supplemented to each flask containing 100ML of MSM media to determine different degradation level. The phenol provided was to serve as a source of carbon and energy and incubate at 25 0C which was observed each 24hours for 4days. The concentration of phenol was analyzed by the high-performance liquid chromatography (Agilent 1200, USA) using a C18 column (4.
6x250mm) to detect the concentration of phenol and metabolites.The operating conditions were done based on temperature, mobile phase, deionized water/acetonitrile (70:30,v/v). The solvent flow rate at 1.0ml/minute and detected at 270nm under Ultraviolent analysis (Liu, Xie et al.
2016). 7.1. The effect of pH , NaCl and temperature regarding the growth of the bacteria isolatedThe effect of temperature on bacteria (strain 119-2) growth in the salty environment was also determined (Abdulkarim, Fatimah et al. 2009). The optimum pH of strain 119-2 growth and degradation of different phenol concentration was considered using LB media and adjusting to pH 5, pH 6, pH 7, pH 8 pH 9, pH 10 ml and pH 11 at 1210C for 20 minutes. Phenol and strain 119-2 was added to the Erlenmeyer flask containing the 100ML of LB media and incubated at 25 0C shaker.
Later, the sample was observed at 600nm (OD600) in every 24hours for 120hrs to checkmate the biomass of strain 119-2 in different pH level. The salt concentration effect of phenol degradation by strain 119-2 was raised to a different salt concentration gradient of 0%, 2%, 4%, 6%, 7%, 8%, 9%, 10% and 11% into a flask containing 100ML of LB media each and, autoclave at 121 0C for 20minutes. Strain 119-2 were inoculated to each flask and incubated at 25 0C shaker. It was determined with OD600 value in every 24hrs from 10hrs to 270hrs.
However, the temperature value from 25 0C, 30 0C, 37 0C and 40 0C was carefully determined using LB media to checkmate the best temperature growths dependent on the effectiveness of biodegradation. Results.The preliminary screening of strain shows that bacteria (strain 119-2) was isolated from samples sites of Quinhai river and has shown a credible growth in MSM with phenol as the sole carbon source and energy. These isolates were named TIBETAN 119-2.
It, however, affirms that when mix other trace carbon source will lead to bacteria growth. The secondary screening of the isolates conducted also shown that the strain 119-2 has phenol degrading capacity and the maximum degrading ability in the preliminary studies were recorded a huge success. The phenol degrading assay of the isolates was compared and it shows that it has the high degradation level of phenol and were termed strain 119-2 kocuria rosea. Morphological feutures of strain 119-2 The strain 119-2 were Gram stained under the microscope which shows that it is a gram-positive bacteria, produces spore and their colonies are cocci, the colour is orange and they have a significant difference in the growth pattern of the colonies on different pH and temperature. Figure 1. shows that the strain 119-2 bacteria base on morphological characteristic is gram-positive
