5221605-396875-628650-396875MASTER THESISIn Order to Obtain theRESEARCH MASTER InImmunologyPresented and defended by:Sara ZalghoutOn Friday September 29, 2017Title Angiotensin II Effect on Vascular Calcification: Target and ApproachSupervisorsDr. Eva HamadeDr. Ghewa Al-AchkarReviewersProf.
Bassam Badran Dr. Michella Ghassibe Université Libanaise -Faculté des sciencesAcknowledgementI would like to express my deepest appreciation to Dr.Eva HAMADE who, despite her many academic and professional commitments, never failed to be the supervisor I needed. Without her guidance, encouragement and persistent support, this thesis would not have been possible.My co-director Dr.Aida HABIB, who accepted me as a master student to work on my project and initiate research in her lab, I would like to express my deepest gratitude and how it is an honor to be a part of her team.
I would also like to thank her for the care and spirits she provided during the course of this thesis.Moreover, I owe the deepest gratitude to Prof. Bassam BADRAN and Dr. Michella GHASSIBE for taking the time to read my report and for giving their valuable comments regarding it.I would also like to express my thanks for Dr. Asaad ZAIDAN and the research assistant Rima Farhat for providing necessary facilities and equipments.
My sincere thanks for the experts, Dr.Ghewa AL-ACHKAR, for her immense patience and support while teaching me lab techniques, data analysis, and following my work step by step; and my lab members especially Abeer Ayoub and Naify Ramadan, who adorned this work with their fingerprints.I would also like to acknowledge my colleagues and friends for their moral support and advice despite of the enormous pressure we were facing together.
Finally, I must express my very profound gratitude to my parents for providing me with unfailing support and continuous encouragement throughout my years of study, for believing in me, and giving me the opportunity for education.Table of Contents TOC o “1-3” h z u Table of Contents PAGEREF _Toc494123129 h 3List of Abbreviations PAGEREF _Toc494123130 h 5List of Tables and Figures PAGEREF _Toc494123131 h 7Abstract PAGEREF _Toc494123132 h 8Chapter I: Introduction PAGEREF _Toc494123133 h 91.Vascular Calcification PAGEREF _Toc494123134 h 92.Bone physiology and mineralization PAGEREF _Toc494123136 h 102.1Biomineralization Process PAGEREF _Toc494123140 h 102.2.Bone and Cartilage proteins: Runx2, OPN, OCN, MGP PAGEREF _Toc494123141 h 123.Physiology of the Aorta PAGEREF _Toc494123146 h 144.
Passive versus active model PAGEREF _Toc494123147 h 165.VSMC plasticity PAGEREF _Toc494123149 h 176.Causes of VC: PAGEREF _Toc494123150 h 186.1.VC and CKD PAGEREF _Toc494123151 h 186.
2.VC and Diabetes PAGEREF _Toc494123152 h 196.3.VC and Atherosclerosis PAGEREF _Toc494123153 h 216.4.
VC and Hypertension PAGEREF _Toc494123154 h 227.Autophagy PAGEREF _Toc494123155 h 257.1.Autophagy and vascular biology PAGEREF _Toc494123156 h 26Aim of the Project PAGEREF _Toc494123157 h 27Chapter II: Materials and methods PAGEREF _Toc494123158 h 282.Experimental Design PAGEREF _Toc494123159 h 283.Von kossa staining PAGEREF _Toc494123160 h 284.Alizarin Red S PAGEREF _Toc494123161 h 285.
DHE experiment PAGEREF _Toc494123162 h 296.RNA Extraction PAGEREF _Toc494123163 h 297.Reverse transcription-PCR: PAGEREF _Toc494123164 h 308.Real-Time PCR PAGEREF _Toc494123165 h 309.
Statistical analysis PAGEREF _Toc494123166 h 30Chapter III: Results PAGEREF _Toc494123167 h 321-Ang II induces aortic arch calcification after 72 hrs incubation (Alizarin Red S and Von Kossa) PAGEREF _Toc494123168 h 322-Ang II induces ROS production after 72 hrs incubation PAGEREF _Toc494123169 h 333.Ang II treatment for 72 hrs induce VSMC trans-differentiation into osteo/chondrocyte like cells PAGEREF _Toc494123170 h 344. Ang II induce inflammation in rat aortic arches after 72 hrs incubation PAGEREF _Toc494123174 h 355. Ang II incubation for 72 hrs enhance PLD1 activity PAGEREF _Toc494123179 h 36Chapter IV: Discussion and Conclusion: PAGEREF _Toc494123183 h 38Chapter V: Future perspectives: PAGEREF _Toc494123187 h 40References: PAGEREF _Toc494123188 h 40List of AbbreviationsAdenosine triphosphate ATPAdvanced glycoprotein end products AGEsAlpha smooth muscle actin ?-SMAAngiotensin type 1 receptor AT1RAngiotensin type 2 receptor AT2RAngiotensin type receptor blocker ARBAnkylosis protein homolog ANKHAnnexin A5 AnxA5Apolipoprotein-E Apo-EBiomineralization foci BMFBone morphogenetic protein BMPCalcium CaCardiovascular disease CVDChronic kidney disease CKDCytochrome p450 27B1 CYP27B1Diacyl glycerol DAGEndoplasmic reticulum ERFatty acids FAsFibroblast growth factor-23 FGF-23Guanosine triphosphate GTPHydrogen peroxide H2O2Hydroxyapatite HAInorganic phosphate PiInorganic pyrophosphate PPiInositol-1,4,5-triphosphate IP3Interleukin 6 IL-6Low density lipoprotein LDLMatrix Gla protein MGPMatrix metalloproteinase MMPMatrix vesicles MVsMitogen activated protein MAPMonocyte chemoattractant protein MCPMyosin light chain kinase MLCKMyosin light chain phosphatase MLCPNicotinamide adenine dinucleotide phosphate NADPHNitric oxide NONuclear factor kappa-B NF-?BOsteocalcin OCNOsteopontin OPNOsteoprotegerin OPGOxidized LDL receptor-1 Parathyroid hormone PTHPeroxisome proliferator-activated receptor gamma PPAR-?Phosphate PPhosphatidic acid PAPhosphatidylcholine PC Phosphatidylethanolamine PE Phosphoethanolamine/phosphocholine phosphatase PHOSPHO1Phospholipase C PLCPhospholipase D PLDProtein kinase C PKCReactive oxygen species ROSReceptor activator of nuclear factor kappa-B RANKRenin Angiotensin aldosterone system RAASRunt-related transcription factor 2 Runx-2Smooth Muscle 22 alpha SM22?Superoxide anion •O2-Superoxide dismutase SODTissue nonspecific alkaline phosphatase TNAPTumor necrosis factor alpha TNF-?Vascular Calcification VCVascular Smooth Muscle Cell VSMCList of Tables and FiguresTable 1: Soluble biomarkers and regulators of calcificationTable 2: List of primers used in qRT-PCR.
Figure 1: Schematic illustration of the process of mineralizationFigure 2: Different types of arterial calcificationFigure 3: Mineralizing VSMC elaborate markers of osteo/chondrocyte like cellFigure 4: Mechanisms whereby Ang II induces vascular injuryFigure 5: Aortic arch calcification induced by 72 hrs incubation with Ang II.Figure 6: Ang II induces ROS generation in rat aortic arches after 72 hrs incubationFigure 7: Trandifferentiation of arterial arch cells into osteo/chondrocyte like cells.Figure 8: Ang II induces inflammation in rat aortic arches after 72 hrs incubation.Figure 9: Ang II induces PLD1 expression in rat aortic arches after 72 hrs incubation.AbstractVascular calcification (VC) is an active and complex process that involves multiple molecular mechanisms leading to calcium deposition in vessel wall. It was considered a passive process that occurs as a result of elevated calcium-phosphate product. However, it is now accepted as an active process where variety of stimuli including hyperphosphatemia, dislipedemia, and oxidative stress induce vascular smooth muscle (VSMC) cells trans-differentiation into osteoblast-like cells. Simultaneous increase in arterial osteochondrocytic programs and reduction in active cellular defense mechanisms demonstrated by loss of inhibitors; create an adequate niche for vascular calcification.
Renin-angiotensin-aldosterone system (RAAS) alterations are widely associated with cardiovascular diseases as Angiotensin II (Ang II) is a potent stimulator of VC. Ang II mediates its effects in vascular injury primarily through inducing oxidative stress and inflammation, and as a consequence, calcification biomarkers are upregulated. In this study, we investigated whether arterial arches calcify following 72 hours treatment with Ang II.
Our results show that Ang II induces reactive oxygen species (ROS) generation and the upregulation of the inflammatory biomarker tumor necrosis factor-? (TNF-?). Moreover, the mRNA level of expression of mineralizing biomarkers osteopontin (OPN) and osteocalcin (OCN) was significantly elevated suggesting VSMC trans-differentiation into osteo/chondrocyte like cells. Thus Ang II treatment for 72 hrs induces arterial arch calcification upon oxidative stress and inflammation stimulation.
Key words: Vascular calcification, VSMC, Ang II, oxidative stress, inflammationChapter I: Introduction1.Vascular CalcificationVascular calcification (VC) is the deposition of hydroxyapatite (HA) crystals in the vasculature. It is considered as a bad clinical outcome and a predictor of cardiovascular adverse events ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3978/j.issn.
2223-3652.2015.06.05″, “ISSN” : “2223-3652”, “PMID” : “26543821”, “abstract” : “Vascular calcification (VC) is the deposition of calcium/phosphate in the vasculature, which portends a worse clinical outcome and predicts major adverse cardiovascular events. VC is an active process initiated and regulated via a variety of molecular signalling pathways. There are mainly two types of calcifications: the media VC and the intima VC. All major risk factors for cardiovascular disease (CVD) have been linked to the presence/development of VC. Besides the risk factors, a genetic component is also operative to determine arterial calcification.
Several events take place before VC is established, including inflammation, trans-differentiation of vascular cells and homing of circulating pro-calcific cells. Diabetes is an important predisposing factor for VC. Compared with non-diabetic subjects, patients with diabetes show increased VC and higher expression of bone-related proteins in the medial layer of the vessels. In this review we will highlight the mechanisms underlying vascular calcification in diabetic patients.”, “author” : { “dropping-particle” : “”, “family” : “Avogaro”, “given” : “Angelo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fadini”, “given” : “Gian Paolo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diagnosis and therapy”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2015” }, “page” : “343-52”, “title” : “Mechanisms of ectopic calcification: implications for diabetic vasculopathy.”, “type” : “article-journal”, “volume” : “5” }, “uris” : “http://www.
mendeley.com/documents/?uuid=c5a83d55-28fe-4953-bba5-91cd8d1ff141″ } , “mendeley” : { “formattedCitation” : “1”, “plainTextFormattedCitation” : “1”, “previouslyFormattedCitation” : “1” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }1. It is one of the mechanisms involved in arterial remodeling which refers to a multitude of structural and functional changes in the vascular wall ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.
3389/fgene.2012.00290″, “ISBN” : “1664-8021”, “ISSN” : “16648021”, “PMID” : “23248645”, “abstract” : “Vascular disease is still the leading cause of morbidity and mortality in the Western world, and the primary cause of myocardial infarction, stroke, and ischemia. The biology of vascular disease is complex and still poorly understood in terms of causes and consequences. Vascular function is determined by structural and functional properties of the arterial vascular wall. Arterial stiffness, that is a pathological alteration of the vascular wall, ultimately results in target-organ damage and increased mortality. Arterial remodeling is accelerated under conditions that adversely affect the balance between arterial function and structure such as hypertension, atherosclerosis, diabetes mellitus, chronic kidney disease, inflammatory disease, lifestyle aspects (smoking), drugs (vitamin K antagonists) and genetic abnormalities (e.
g. pseudoxanthoma elasticum, Marfanu2019s disease). The aim of this review is to provide an overview of the complex mechanisms and different factors that underlie arterial remodeling, learning from single gene defect diseases like PXE, and PXE-like, Marfanu2019s disease and Keutel syndrome in vascular remodeling.
“, “author” : { “dropping-particle” : “”, “family” : “Varik”, “given” : “Bernard J.”, “non-dropping-particle” : “Van”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rennenberg”, “given” : “Roger J M W”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Reutelingsperger”, “given” : “Chris P.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kroon”, “given” : “Abraham A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Leeuw”, “given” : “Peter W.”, “non-dropping-particle” : “De”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Schurgers”, “given” : “Leon J.
“, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Genetics”, “id” : “ITEM-1”, “issue” : “DEC”, “issued” : { “date-parts” : “2012” }, “title” : “Mechanisms of arterial remodeling: Lessons from genetic diseases”, “type” : “article”, “volume” : “3” }, “uris” : “http://www.mendeley.com/documents/?uuid=f1b95967-63fe-4058-bc78-758fb7e18f51” } , “mendeley” : { “formattedCitation” : “2”, “plainTextFormattedCitation” : “2”, “previouslyFormattedCitation” : “2” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.
com/citation-style-language/schema/raw/master/csl-citation.json” }2. The process of VC is highly similar to physiological mineralization however it occurs in soft tissues (kidney, articular cartilage, cardiovascular tissues) rather than hard ones (bone, cartilage, dentin) ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1111/j.1440-1746.
2005.04220.x”, “ISBN” : “1040-8711 (Print)
1040-8711 (Linking)”, “ISSN” : “10408711”, “PMID” : “16462525”, “abstract” : “PURPOSE OF REVIEW: Physiological mineralization is necessary for the formation of skeletal tissues and for their appropriate functions during adulthood. Pathological or ectopic mineralization of soft tissues, including articular cartilage and cardiovascular tissues, leads to morbidity and mortality. Recent findings suggest that the mechanisms and factors regulating physiological mineralization may be identical or similar to those regulating ectopic mineralization.
Therefore, the purpose of this review is to describe the current knowledge of mechanisms and determinants that regulate physiological mineralization and how these determinants can be used to understand ectopic mineralization better. RECENT FINDINGS: Recent findings have indicated that physiological and pathological mineralization are initiated by matrix vesicles, membrane-enclosed particles released from the plasma membrane of mineralization-competent cells. An understanding of how these vesicles initiate the physiological mineralization process may provide novel therapeutic strategies to prevent ectopic mineralization. In addition, other regulators (activators and inhibitors) of physiological mineralization have been identified and characterized, and evidence indicates that the same factors also contribute to the regulation of ectopic mineralization. Finally, programmed cell death (apoptosis) may be a contributor to physiological mineralization, and if occurring after tissue injury may induce ectopic mineralization and mineralization-related differentiation events in the injured area and surrounding areas. SUMMARY: This review describes how the understanding of mechanisms and factors regulating physiological mineralization can be used to develop new therapeutic strategies to prevent pathological or ectopic mineralization events.”, “author” : { “dropping-particle” : “”, “family” : “Kirsch”, “given” : “Thorsten”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Opinion in Rheumatology”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2006” }, “page” : “174-180”, “title” : “Determinants of pathological mineralization”, “type” : “article”, “volume” : “18” }, “uris” : “http://www.
mendeley.com/documents/?uuid=172b0137-9156-4906-b24c-7bdab6d9456e” } , “mendeley” : { “formattedCitation” : “3”, “plainTextFormattedCitation” : “3”, “previouslyFormattedCitation” : “3” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }3.
VC is complex and involves the trans-differentiation of vascular smooth muscle cells (VSMC) into osteo/chondrocyte like cells associated with an increase in osteogenic proteins ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1210/er.2003-0015”, “ISBN” : “0163-769X (Print)”, “ISSN” : “0163769X”, “PMID” : “15294885”, “abstract” : “Pathologists have recognized arterial calcification for over a century. Recent years have witnessed a strong resurgence of interest in atherosclerotic plaque calcification because it: 1) can be easily detected noninvasively; 2) closely correlates with the amount of atherosclerotic plaque; 3) serves as a surrogate measure for atherosclerosis, allowing preclinical detection of the disease; and 4) is associated with heightened risk of adverse cardiovascular events. There are two major types of calcification in arteries: calcification of the media tunica layer (sometimes called Mu00f6nckeberg’s sclerosis), and calcification within subdomains of atherosclerotic plaque within the intimal layer of the artery. There are important similarities and differences between these two entities. Of particular interest are increasing parallels between cellular and molecular features of arterial calcification and bone biology, and this has led to accelerating interest in understanding how and why bone-like mineral deposits may form in arteries. Here, we review the two major pathological types of arterial calcification, the proposed models of calcification, and endocrine and genetic determinants that affect arterial calcification.
In addition, we highlight areas requiring further investigation.”, “author” : { “dropping-particle” : “”, “family” : “Doherty”, “given” : “Terence M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fitzpatrick”, “given” : “Lorraine A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Inoue”, “given” : “Daisuke”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Qiao”, “given” : “Jian Hua”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fishbein”, “given” : “Michael C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Detrano”, “given” : “Robert C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shah”, “given” : “Prediman K.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rajavashisth”, “given” : “Tripathi B.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Endocrine Reviews”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2004” }, “page” : “629-672”, “title” : “Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification”, “type” : “article”, “volume” : “25” }, “uris” : “http://www.
mendeley.com/documents/?uuid=a9b6d01d-e6ad-4aea-8655-072928f7d6b3″ } , “mendeley” : { “formattedCitation” : “4”, “plainTextFormattedCitation” : “4”, “previouslyFormattedCitation” : “4” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.
json” }4. It occurs due to the loss of coordination between stimulatory and inhibitory factors including chemical compounds, enzymes, and proteins (discussed later) ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3978/j.issn.2223-3652.
2015.06.05″, “ISSN” : “2223-3652”, “PMID” : “26543821”, “abstract” : “Vascular calcification (VC) is the deposition of calcium/phosphate in the vasculature, which portends a worse clinical outcome and predicts major adverse cardiovascular events. VC is an active process initiated and regulated via a variety of molecular signalling pathways. There are mainly two types of calcifications: the media VC and the intima VC. All major risk factors for cardiovascular disease (CVD) have been linked to the presence/development of VC. Besides the risk factors, a genetic component is also operative to determine arterial calcification.
Several events take place before VC is established, including inflammation, trans-differentiation of vascular cells and homing of circulating pro-calcific cells. Diabetes is an important predisposing factor for VC. Compared with non-diabetic subjects, patients with diabetes show increased VC and higher expression of bone-related proteins in the medial layer of the vessels. In this review we will highlight the mechanisms underlying vascular calcification in diabetic patients.”, “author” : { “dropping-particle” : “”, “family” : “Avogaro”, “given” : “Angelo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fadini”, “given” : “Gian Paolo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diagnosis and therapy”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2015” }, “page” : “343-52”, “title” : “Mechanisms of ectopic calcification: implications for diabetic vasculopathy.”, “type” : “article-journal”, “volume” : “5” }, “uris” : “http://www.mendeley.
com/documents/?uuid=c5a83d55-28fe-4953-bba5-91cd8d1ff141″ } , “mendeley” : { “formattedCitation” : “1”, “plainTextFormattedCitation” : “1”, “previouslyFormattedCitation” : “1” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }1.Of the various tissues vulnerable to ectopic calcification, VC is the most worrying considered as a complexity leading to increased morbidity and mortality associated with cardiovascular diseases ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1038/nrendo.
2012.36″, “ISBN” : “1759-5037 (Electronic)
1759-5029 (Linking)”, “ISSN” : “1759-5029”, “PMID” : “22473330”, “abstract” : “Bone never forms without vascular interactions. This simple statement of fact does not adequately reflect the physiological and pharmacological implications of the relationship.
The vasculature is the conduit for nutrient exchange between bone and the rest of the body. The vasculature provides the sustentacular niche for development of osteoblast progenitors and is the conduit for egress of bone marrow cell products arising, in turn, from the osteoblast-dependent haematopoietic niche. Importantly, the second most calcified structure in humans after the skeleton is the vasculature. Once considered a passive process of dead and dying cells, vascular calcification has emerged as an actively regulated form of tissue biomineralization. Skeletal morphogens and osteochondrogenic transcription factors are expressed by cells within the vessel wall, which regulates the deposition of vascular calcium. Osteotropic hormones, including parathyroid hormone, regulate both vascular and skeletal mineralization. Cellular, endocrine and metabolic signals that flow bidirectionally between the vasculature and bone are necessary for both bone health and vascular health. Dysmetabolic states including diabetes mellitus, uraemia and hyperlipidaemia perturb the bone-vascular axis, giving rise to devastating vascular and skeletal disease.
A detailed understanding of bone-vascular interactions is necessary to address the unmet clinical needs of an increasingly aged and dysmetabolic population.”, “author” : { “dropping-particle” : “”, “family” : “Thompson”, “given” : “Bithika”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Towler”, “given” : “Dwight a.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nature Reviews Endocrinology”, “id” : “ITEM-1”, “issue” : “9”, “issued” : { “date-parts” : “2012” }, “page” : “529-543”, “title” : “Arterial calcification and bone physiology: role of the boneu2013vascular axis”, “type” : “article-journal”, “volume” : “8” }, “uris” : “http://www.mendeley.
com/documents/?uuid=5eeba70a-3bea-4833-908a-67c3be6f65f9″ } , “mendeley” : { “formattedCitation” : “5”, “plainTextFormattedCitation” : “5”, “previouslyFormattedCitation” : “5” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }5. Individuals with particular conditions are greatly prone to develop soft tissue calcification including elderly, individuals with specific life style aspects, metabolic or hormonal disorders, or with genetic diseases ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3389/fgene.
2012.00290″, “ISBN” : “1664-8021”, “ISSN” : “16648021”, “PMID” : “23248645”, “abstract” : “Vascular disease is still the leading cause of morbidity and mortality in the Western world, and the primary cause of myocardial infarction, stroke, and ischemia. The biology of vascular disease is complex and still poorly understood in terms of causes and consequences.
Vascular function is determined by structural and functional properties of the arterial vascular wall. Arterial stiffness, that is a pathological alteration of the vascular wall, ultimately results in target-organ damage and increased mortality. Arterial remodeling is accelerated under conditions that adversely affect the balance between arterial function and structure such as hypertension, atherosclerosis, diabetes mellitus, chronic kidney disease, inflammatory disease, lifestyle aspects (smoking), drugs (vitamin K antagonists) and genetic abnormalities (e.g.
pseudoxanthoma elasticum, Marfanu2019s disease). The aim of this review is to provide an overview of the complex mechanisms and different factors that underlie arterial remodeling, learning from single gene defect diseases like PXE, and PXE-like, Marfanu2019s disease and Keutel syndrome in vascular remodeling.”, “author” : { “dropping-particle” : “”, “family” : “Varik”, “given” : “Bernard J.”, “non-dropping-particle” : “Van”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rennenberg”, “given” : “Roger J M W”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Reutelingsperger”, “given” : “Chris P.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kroon”, “given” : “Abraham A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Leeuw”, “given” : “Peter W.”, “non-dropping-particle” : “De”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Schurgers”, “given” : “Leon J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Genetics”, “id” : “ITEM-1”, “issue” : “DEC”, “issued” : { “date-parts” : “2012” }, “title” : “Mechanisms of arterial remodeling: Lessons from genetic diseases”, “type” : “article”, “volume” : “3” }, “uris” : “http://www.
mendeley.com/documents/?uuid=f1b95967-63fe-4058-bc78-758fb7e18f51″ } , “mendeley” : { “formattedCitation” : “2”, “plainTextFormattedCitation” : “2”, “previouslyFormattedCitation” : “2” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }2.
VSMC in advanced aged individuals increase the expression of senescence markers ‘prelamin A’ involved in DNA damage and disrupting mitosis favoring VC ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/CIRCULATIONAHA.113.003341”, “ISSN” : “00097322”, “PMID” : “23690467”, “abstract” : “Vascular calcification, once considered a passive consequence of aging, is now recognized to be a highly regulated process akin to bone formation. Vascular calcification is prevalent across ethnicities and age groups and observational studies show an interaction with aging in asymptomatic adults and in individuals with established coronary artery disease.1, 2 Recent findings from the HORUS study have shown that the link between aging and vascular calcification is an age-old association. In this study, 137 mummies up to 4.
000 years old were examined with CT scans. Vascular calcification was present in 47/137 or 34% of the mummies and the age at the time of death correlated positively with the presence of vascular calcification as well as the number of vascular beds with calcified vessels.3 In the modern era, the incidence of vascular calcification has been shown to increase with advancing age and has been reported to be ;5% annually for individuals ;50 years of age to ;12% for individuals ;80 years of age.2 When present, vascular calcification portends a worse clinical outcome; a meta-analysis of 218,000 patients found a 3.
94-fold higher risk for cardiovascular mortality and a 3.41-fold higher risk for any cardiovascular event.4 Thus, understanding how aging influences the pathobiology of vascular calcification may have far-reaching implications for associated cardiovascular morbidity and mortality.”, “author” : { “dropping-particle” : “”, “family” : “Leopold”, “given” : “Jane A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Circulation”, “id” : “ITEM-1”, “issue” : “24”, “issued” : { “date-parts” : “2013” }, “page” : “2380-2382”, “title” : “Vascular calcification an age-old problem of old age”, “type” : “article-magazine”, “volume” : “127” }, “uris” : “http://www.mendeley.com/documents/?uuid=46865e21-5b7f-465e-afef-0454642d1489” } , “mendeley” : { “formattedCitation” : “6”, “plainTextFormattedCitation” : “6”, “previouslyFormattedCitation” : “6” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.
json” }6. Moreover, exogenous excessive generation and inhalation of free radicals from cigarette smoking induce oxidative stress, the process greatly associated with cardiovascular disease ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3389/fphar.
2016.00397″, “ISSN” : “16639812”, “abstract” : “u00a9 2016 Al Hariri, Zibara, Farhat, Hashem, Soudani, Al Ibrahim, Hamade, Zeidan, Husari and Kobeissy.Background: Cardiovascular diseases are the leading causes of morbidity and mortality worldwide. Cigarette smoking remains a global health epidemic with associated detrimental effects on the cardiovascular system. In this work, we investigated the effects of cigarette smoke exposure on cardiovascular system in an animal model. The study then evaluated the effects of antioxidants (AO), represented by pomegranate juice, on cigarette smoke induced cardiovascular injury. This study aims at evaluating the effect of pomegranate juice supplementation on the cardiovascular system of an experimental rat model of smoke exposure.
Methods: Adult rats were divided into four different groups: Control, Cigarette smoking (CS), AO, and CS + AO. Cigarette smoke exposure was for 4 weeks (5 days of exposure/week) and AO group received pomegranate juice while other groups received placebo. Assessment of cardiovascular injury was documented by assessing different parameters of cardiovascular injury mediators including: (1) cardiac hypertrophy, (2) oxidative stress, (3) expression of inflammatory markers, (4) expression of Bradykinin receptor 1 (Bdkrb1), Bradykinin receptor 2 (Bdkrb2), and (5) altered expression of fibrotic/atherogenic markers (Fibronectin (Fn1) and leptin receptor (ObR)). Results: Data from this work demonstrated that cigarette smoke exposure induced cardiac hypertrophy, which was reduced upon administration of pomegranate in CS + AO group. Cigarette smoke exposure was associated with elevation in oxidative stress, significant increase in the expression of IL-1u00df, TNFa, Fn1, and ObR in rat’s aorta. In addition, an increase in aortic calcification was observed after 1 month of cigarette smoke exposure. Furthermore, cigarette smoke induced a significant up regulation in Bdkrb1 expression level.
Finally, pomegranate supplementation exhibited cardiovascular protection assessed by the above findings and partly contributed to ameliorating cardiac hypertrophy in cigarette smoke exposed animals. Conclusion: Findings from this work showed that cigarette smoking exposure is associated with significant cardiovascular pathology such as cardiac hypertrophy, inflammation, pro-fibrotic, and atherogenic markers and aortic calcification in an animal model as assessed 1 month post exposure. Antioxidant supplementation prevented cardiac hypertrophy and attenuated indicators of au2026″, “author” : { “dropping-particle” : “”, “family” : “Hariri”, “given” : “Moustafa”, “non-dropping-particle” : “Al”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Zibara”, “given” : “Kazem”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Farhat”, “given” : “Wissam”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Hashem”, “given” : “Yasmine”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Soudani”, “given” : “Nadia”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Ibrahim”, “given” : “Farah”, “non-dropping-particle” : “Al”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Hamade”, “given” : “Eva”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Zeidan”, “given” : “Asad”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Husari”, “given” : “Ahmad”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kobeissy”, “given” : “Firas”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Pharmacology”, “id” : “ITEM-1”, “issue” : “NOV”, “issued” : { “date-parts” : “2016” }, “title” : “Cigarette smoking-induced cardiac hypertrophy, vascular inflammation and injury are attenuated by antioxidant supplementation in an animal model”, “type” : “article-journal”, “volume” : “7” }, “uris” : “http://www.mendeley.com/documents/?uuid=2d0d158d-73ee-426e-b921-1c1618b84d75” } , “mendeley” : { “formattedCitation” : “7”, “plainTextFormattedCitation” : “7”, “previouslyFormattedCitation” : “7” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.
json” }7. Hyperglycemia also induces oxidative and osmotic stress activating vascular inflammatory cells and inducing VSMC trans-differentiation. A major contributor of VC pathology is hyperphosphatemia in patients with chronic kidney disease (CKD) as considered a great risk factor of calcium accumulation in vessel wall, in addition increased parathyroid hormone (PTH) in patients with CKD inhibit osteoprotegerin (OPG), main osteoprotective factor ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.12659/MSM.882181”, “ISBN” : “1234-1010”, “ISSN” : “1234-1010”, “PMID” : “22207127”, “abstract” : “Calcification of vessels reduces their elasticity, affecting hemodynamic parameters of the cardiovascular system.
The development of arterial hypertension, cardiac hypertrophy, ischemic heart disease or peripheral arterial disease significantly increases mortality in patients over 60 years of age. Stage of advancement and the extent of accumulation of calcium deposits in vessel walls are key risk factors of ischemic events. Vascular calcification is an active and complex process that involves numerous mechanisms responsible for calcium depositions in arterial walls. They lead to increase in arterial stiffness and in pulse wave velocity, which in turn increases cardiovascular disease morbidity and mortality. In-depth study and thorough understanding of vascular calcification mechanisms may be crucial for establishing an effective vasculoprotective therapy.
The aim of this study was to present a comprehensive survey of current state-of-the-art research into the impact of metabolic and hormonal disorders on development of vascular calcification. Due to strong resemblance to the processes occurring in bone tissue, drugs used for osteoporosis treatment (calcitriol, estradiol, bisphosphonates) may interfere with the processes occurring in the vessel wall. On the other hand, drugs used to treat cardiovascular problems (statins, angiotensin convertase inhibitors, warfarin, heparins) may have an effect on bone tissue metabolism. Efforts to optimally control calcium and phosphate concentrations are also beneficial for patients with end-stage renal disease, for whom vessel calcification remains a major problem.”, “author” : { “dropping-particle” : “”, “family” : “Karwowski”, “given” : “Wojciech”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Naumnik”, “given” : “Beata”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Szczepau0144ski”, “given” : “Marek”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Myu015bliwiec”, “given” : “Michal”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Medical Science Monitor”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2012” }, “page” : “RA1-RA11”, “title” : “The mechanism of vascular calcification u2013 a systematic review”, “type” : “article-journal”, “volume” : “18” }, “uris” : “http://www.
mendeley.com/documents/?uuid=b9802642-5f48-4d76-ac73-92929c4728d3″ } , “mendeley” : { “formattedCitation” : “8”, “plainTextFormattedCitation” : “8”, “previouslyFormattedCitation” : “8” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }8. Hypervitamosis D is associated with extensive arterial calcium phosphate deposit and upregulation of proteins regulating mineralizationADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1159/000299794”, “ISBN” : “1421-9670 (Electronic)
0250-8095 (Linking)”, “ISSN” : “1460-2385”, “PMID” : “20413965”, “abstract” : “Vascular calcification is a significant contributor to the cardiovascular mortality observed in chronic kidney disease (CKD). This review discusses the animal models (5/6 nephrectomy, mouse electrocautery model and dietary adenine) that have been employed in the study of vascular calcification outcomes in CKD.
Rodent models of CKD generate a range of severity in the vascular calcification phenotype. Major limitations of the 5/6th nephrectomy model include the requirement for surgery and the need to use either excessive dietary phosphorus or vitamin D. Major limitations of the mouse electrocautery model include the requirement for surgery, the mortality rate when very advanced CKD develops, and resistance to vascular calcification without the use of transgenic animals.
This is balanced against the major advantage of the ability to study transgenic animals to further understand the mechanisms associated with either the acceleration or inhibition of calcification. Dietary adenine generates severe CKD and does not require surgery. The major disadvantage is the weight loss that ensues when rats receive a diet containing 0.75% adenine.
In summary, animal models are useful to study CKD-associated vascular calcification and the results obtained in these pre-clinical animal studies appear to translate to the evidence, however limited, which exists in humans with CKD.”, “author” : { “dropping-particle” : “”, “family” : “Hsu”, “given” : “Jeffrey J”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Tintut”, “given” : “Yin”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Demer”, “given” : “Linda L”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shobeiri”, “given” : “Navid”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Adams”, “given” : “Michael A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Holden”, “given” : “Rachel M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Dru00fceke”, “given” : “Tilman B”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Massy”, “given” : “Ziad a”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “American Journal of Nephrology”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2010” }, “page” : “1704-7”, “title” : “Role of vitamin D in vascular calcification: bad guy or good guy?”, “type” : “article-journal”, “volume” : “27” }, “uris” : “http://www.mendeley.com/documents/?uuid=ce690c8c-fdb9-4334-ba8e-88a17ad183e3” } , “mendeley” : { “formattedCitation” : “9”, “plainTextFormattedCitation” : “9”, “previouslyFormattedCitation” : “9” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.
json” }9. Mutation in the gene encoding fibroblast growth factor-23 (FGF-23) contribute to VC in CKD patients as it functions in the inhibition of tubular phosphate reabsorption ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.12659/MSM.882181”, “ISBN” : “1234-1010”, “ISSN” : “1234-1010”, “PMID” : “22207127”, “abstract” : “Calcification of vessels reduces their elasticity, affecting hemodynamic parameters of the cardiovascular system.
The development of arterial hypertension, cardiac hypertrophy, ischemic heart disease or peripheral arterial disease significantly increases mortality in patients over 60 years of age. Stage of advancement and the extent of accumulation of calcium deposits in vessel walls are key risk factors of ischemic events. Vascular calcification is an active and complex process that involves numerous mechanisms responsible for calcium depositions in arterial walls. They lead to increase in arterial stiffness and in pulse wave velocity, which in turn increases cardiovascular disease morbidity and mortality. In-depth study and thorough understanding of vascular calcification mechanisms may be crucial for establishing an effective vasculoprotective therapy. The aim of this study was to present a comprehensive survey of current state-of-the-art research into the impact of metabolic and hormonal disorders on development of vascular calcification. Due to strong resemblance to the processes occurring in bone tissue, drugs used for osteoporosis treatment (calcitriol, estradiol, bisphosphonates) may interfere with the processes occurring in the vessel wall.
On the other hand, drugs used to treat cardiovascular problems (statins, angiotensin convertase inhibitors, warfarin, heparins) may have an effect on bone tissue metabolism. Efforts to optimally control calcium and phosphate concentrations are also beneficial for patients with end-stage renal disease, for whom vessel calcification remains a major problem.”, “author” : { “dropping-particle” : “”, “family” : “Karwowski”, “given” : “Wojciech”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Naumnik”, “given” : “Beata”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Szczepau0144ski”, “given” : “Marek”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Myu015bliwiec”, “given” : “Michal”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Medical Science Monitor”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2012” }, “page” : “RA1-RA11”, “title” : “The mechanism of vascular calcification u2013 a systematic review”, “type” : “article-journal”, “volume” : “18” }, “uris” : “http://www.mendeley.com/documents/?uuid=b9802642-5f48-4d76-ac73-92929c4728d3” } , “mendeley” : { “formattedCitation” : “8”, “plainTextFormattedCitation” : “8”, “previouslyFormattedCitation” : “8” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }8.
Moreover, calcification is a hallmark of patients with genetic diseases, including, Keutel syndrome, Psedoxanthoma elasticum (PXE) and PXE-like syndrome ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3389/fgene.2012.00290”, “ISBN” : “1664-8021”, “ISSN” : “16648021”, “PMID” : “23248645”, “abstract” : “Vascular disease is still the leading cause of morbidity and mortality in the Western world, and the primary cause of myocardial infarction, stroke, and ischemia. The biology of vascular disease is complex and still poorly understood in terms of causes and consequences. Vascular function is determined by structural and functional properties of the arterial vascular wall. Arterial stiffness, that is a pathological alteration of the vascular wall, ultimately results in target-organ damage and increased mortality. Arterial remodeling is accelerated under conditions that adversely affect the balance between arterial function and structure such as hypertension, atherosclerosis, diabetes mellitus, chronic kidney disease, inflammatory disease, lifestyle aspects (smoking), drugs (vitamin K antagonists) and genetic abnormalities (e.
g. pseudoxanthoma elasticum, Marfanu2019s disease). The aim of this review is to provide an overview of the complex mechanisms and different factors that underlie arterial remodeling, learning from single gene defect diseases like PXE, and PXE-like, Marfanu2019s disease and Keutel syndrome in vascular remodeling.”, “author” : { “dropping-particle” : “”, “family” : “Varik”, “given” : “Bernard J.”, “non-dropping-particle” : “Van”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rennenberg”, “given” : “Roger J M W”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Reutelingsperger”, “given” : “Chris P.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kroon”, “given” : “Abraham A.
“, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Leeuw”, “given” : “Peter W.”, “non-dropping-particle” : “De”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Schurgers”, “given” : “Leon J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Genetics”, “id” : “ITEM-1”, “issue” : “DEC”, “issued” : { “date-parts” : “2012” }, “title” : “Mechanisms of arterial remodeling: Lessons from genetic diseases”, “type” : “article”, “volume” : “3” }, “uris” : “http://www.mendeley.com/documents/?uuid=f1b95967-63fe-4058-bc78-758fb7e18f51” } , “mendeley” : { “formattedCitation” : “2”, “plainTextFormattedCitation” : “2”, “previouslyFormattedCitation” : “2” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.
json” }2.2.Bone physiology and mineralizationBone is a highly specialized connective tissue which has important physiological and mechanical functions ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1016/j.mpsur.2014.10.
010″, “ISBN” : “1359-0286”, “ISSN” : “18781764”, “PMID” : “600770001”, “abstract” : “The skeleton has structural and locomotor functions, and is a mineral reservoir. Bone turnover by osteoclasts and osteoblasts is a lifelong process, incorporating growth, modelling and remodelling to repair microdamage and access the mineral reservoir. Signalling between bone cells is essential for the coordination of these processes. Osteoblasts regulate osteoclast activity through the receptor activator of nuclear factor-u03baB (RANK)/RANK ligand/osteoprotegerin system, and osteocytes regulate osteoblast activity through sclerostin secretion. If resorption and formation are balanced there is no net change in bone mass after each cycle, but with ageing and some disease states resorption exceeds formation leading to remodelling imbalance, decreased bone mass and loss of microstructural integrity.
The rate of remodelling is determined by loading and endocrine influences. The most important endocrine regulator of bone turnover is probably oestrogen, but other hormones regulating bone metabolism include insulin-like growth factor-1, parathyroid hormone and gut and adipocyte hormones.”, “author” : { “dropping-particle” : “”, “family” : “Walsh”, “given” : “Jennifer S.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Surgery (United Kingdom)”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2015” }, “page” : “1-6”, “title” : “Normal bone physiology, remodelling and its hormonal regulation”, “type” : “article-journal”, “volume” : “33” }, “uris” : “http://www.mendeley.com/documents/?uuid=f7341023-3274-4ae3-a047-0f40b05c4650” } , “mendeley” : { “formattedCitation” : “10”, “plainTextFormattedCitation” : “10”, “previouslyFormattedCitation” : “10” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }10.
In addition to its role in providing rigidity to the skeleton for locomotion and protection of visceral organs; it plays other crucial vital functions ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.2215/CJN.04151206”, “ISBN” : “5072845745”, “ISSN” : “1555905X”, “PMID” : “18988698”, “abstract” : “This review describes normal bone anatomy and physiology as an introduction to the subsequent articles in this section that discuss clinical applications of iliac crest bone biopsy. The normal anatomy and functions of the skeleton are reviewed first, followed by a general description of the processes of bone modeling and remodeling. The bone remodeling process regulates the gain and loss of bone mineral density in the adult skeleton and directly influences bone strength. Thorough understanding of the bone remodeling process is critical to appreciation of the value of and interpretation of the results of iliac crest bone histomorphometry. Osteoclast recruitment, activation, and bone resorption is discussed in some detail, followed by a review of osteoblast recruitment and the process of new bone formation.
Next, the collagenous and noncollagenous protein components and function of bone extracellular matrix are summarized, followed by a description of the process of mineralization of newly formed bone matrix. The actions of biomechanical forces on bone are sensed by the osteocyte syncytium within bone via the canalicular network and intercellular gap junctions. Finally, concepts regarding bone remodeling, osteoclast and osteoblast function, extracellular matrix, matrix mineralization, and osteocyte function are synthesized in a summary of the currently understood functional determinants of bone strength. This information lays the groundwork for understanding the utility and clinical applications of iliac crest bone biopsy.”, “author” : { “dropping-particle” : “”, “family” : “Clarke”, “given” : “Bart”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Clinical journal of the American Society of Nephrology : CJASN”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2008” }, “title” : “Normal bone anatomy and physiology.
“, “type” : “article”, “volume” : “3 Suppl 3” }, “uris” : “http://www.mendeley.com/documents/?uuid=7579bb2e-7177-4df0-89a9-864c78aa764e” } , “mendeley” : { “formattedCitation” : “11”, “plainTextFormattedCitation” : “11”, “previouslyFormattedCitation” : “11” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }11. Bone formation occurs by either process: endochondral ossification or intramembraneous ossification ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.
1016/j.bone.2015.04.035″, “ISBN” : “1081-0706”, “ISSN” : “87563282”, “PMID” : “26453494”, “abstract” : “The development of the vertebrate skeleton reflects its evolutionary history. Cartilage formation came before biomineralization and a head skeleton evolved before the formation of axial and appendicular skeletal structures. This review describes the processes that result in endochondral and intramembranous ossification, the important roles of growth and transcription factors, and the consequences of mutations in some of the genes involved.
Following a summary of the origin of cartilage, muscle, and tendon cell lineages in the axial skeleton, we discuss the role of muscle forces in the formation of skeletal architecture and assembly of musculoskeletal functional units. Finally, ontogenetic patterning of bones in response to mechanical loading is reviewed.This article is part of a Special Issue entitled “Muscle Bone Interactions”.”, “author” : { “dropping-particle” : “”, “family” : “Berendsen”, “given” : “Agnes D.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Olsen”, “given” : “Bjorn R.
“, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Bone”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2015” }, “page” : “14-18”, “title” : “Bone development”, “type” : “article”, “volume” : “80” }, “uris” : “http://www.mendeley.com/documents/?uuid=0a159020-e1bf-452c-b606-0df611db41e5” } , “mendeley” : { “formattedCitation” : “12”, “plainTextFormattedCitation” : “12”, “previouslyFormattedCitation” : “12” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }12. Bone as a structure consists of matrix, minerals and osteogenic cells.
The matrix is composed mainly of type I collagen, proteoglycans, and non-collagenous proteins including osteopontin (OPN), osteocalcin (OCN) and osteonectin secreted by osteoblasts. Two thirds of total bone matrix is made up of HA crystals or calcium phosphate ions. Other minerals include magnesium, potassium, and sodium ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1016/j.mpsur.2014.
10.010″, “ISBN” : “1359-0286”, “ISSN” : “18781764”, “PMID” : “600770001”, “abstract” : “The skeleton has structural and locomotor functions, and is a mineral reservoir. Bone turnover by osteoclasts and osteoblasts is a lifelong process, incorporating growth, modelling and remodelling to repair microdamage and access the mineral reservoir. Signalling between bone cells is essential for the coordination of these processes. Osteoblasts regulate osteoclast activity through the receptor activator of nuclear factor-u03baB (RANK)/RANK ligand/osteoprotegerin system, and osteocytes regulate osteoblast activity through sclerostin secretion.
If resorption and formation are balanced there is no net change in bone mass after each cycle, but with ageing and some disease states resorption exceeds formation leading to remodelling imbalance, decreased bone mass and loss of microstructural integrity. The rate of remodelling is determined by loading and endocrine influences. The most important endocrine regulator of bone turnover is probably oestrogen, but other hormones regulating bone metabolism include insulin-like growth factor-1, parathyroid hormone and gut and adipocyte hormones.”, “author” : { “dropping-particle” : “”, “family” : “Walsh”, “given” : “Jennifer S.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Surgery (United Kingdom)”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2015” }, “page” : “1-6”, “title” : “Normal bone physiology, remodelling and its hormonal regulation”, “type” : “article-journal”, “volume” : “33” }, “uris” : “http://www.mendeley.com/documents/?uuid=f7341023-3274-4ae3-a047-0f40b05c4650” } , “mendeley” : { “formattedCitation” : “10”, “plainTextFormattedCitation” : “10”, “previouslyFormattedCitation” : “10” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.
com/citation-style-language/schema/raw/master/csl-citation.json” }10.Cells within the bone include osteoblast, osteoclast, and osteocytes. Osteoblasts major function is the synthesis of collagen and organic matrix. Osteoclasts functions in bone remodeling i.
e. degradation of the bone matrix by the release of acid and lytic enzymes ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1038/nature01658”, “ISBN” : “0028-0836 (Print)
0028-0836 (Linking)”, “ISSN” : “0028-0836”, “PMID” : “12748652”, “abstract” : “Osteoclasts are specialized cells derived from the monocyte/macrophage haematopoietic lineage that develop and adhere to bone matrix, then secrete acid and lytic enzymes that degrade it in a specialized, extracellular compartment. Discovery of the RANK signalling pathway in the osteoclast has provided insight into the mechanisms of osteoclastogenesis and activation of bone resorption, and how hormonal signals impact bone structure and mass. Further study of this pathway is providing the molecular basis for developing therapeutics to treat osteoporosis and other diseases of bone loss.
“, “author” : { “dropping-particle” : “”, “family” : “Boyle”, “given” : “William J”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Simonet”, “given” : “W Scott”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Lacey”, “given” : “David L”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nature”, “id” : “ITEM-1”, “issue” : “6937”, “issued” : { “date-parts” : “2003” }, “page” : “337-42”, “title” : “Osteoclast differentiation and activation.”, “type” : “article-journal”, “volume” : “423” }, “uris” : “http://www.mendeley.com/documents/?uuid=6d5bc4e8-a810-4e01-b140-c67f6765d654” } , “mendeley” : { “formattedCitation” : “13”, “plainTextFormattedCitation” : “13”, “previouslyFormattedCitation” : “13” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }13. Osteocytes act as mechanosensors converting the mechanical force stimulus into biochemical signals and actively involved in bone turnover ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11154-010-9153-1”, “ISBN” : “1573-2606 (Electronic)
1389-9155 (Linking)”, “ISSN” : “1573-2606”, “PMID” : “21188536”, “abstract” : “Bone remodeling is a tightly regulated process securing repair of microdamage (targeted remodeling) and replacement of old bone with new bone through sequential osteoclastic resorption and osteoblastic bone formation.
The rate of remodeling is regulated by a wide variety of calcitropic hormones (PTH, thyroid hormone, sex steroids etc.). In recent years we have come to appreciate that bone remodeling proceeds in a specialized vascular structure,–the Bone Remodeling Compartment (BRC). The outer lining of this compartment is made up of flattened cells, displaying all the characteristics of lining cells in bone including expression of OPG and RANKL. Reduced bone turnover leads to a decrease in the number of BRCs, while increased turnover causes an increase in the number of BRCs. The secretion of regulatory factors inside a confined space separated from the bone marrow would facilitate local regulation of the remodeling process without interference from growth factors secreted by blood cells in the marrow space. The BRC also creates an environment where cells inside the structure are exposed to denuded bone, which may enable direct cellular interactions with integrins and other matrix factors known to regulate osteoclast/osteoblast activity.
However, the denuded bone surface inside the BRC also constitutes an ideal environment for the seeding of bone metastases, known to have high affinity for bone matrix. Circulating osteoclast- and osteoblast precursor cells have been demonstrated in peripheral blood. The dominant pathway regulating osteoclast recruitment is the RANKL/OPG system, while many different factors (RUNX, Osterix) are involved in osteoblast differentiation. Both pathways are modulated by calcitropic hormones.”, “author” : { “dropping-particle” : “”, “family” : “Eriksen”, “given” : “E F”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Rev Endocr Metab Disord”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2010” }, “page” : “219-227”, “title” : “Cellular mechanisms of bone remodeling”, “type” : “article-journal”, “volume” : “11” }, “uris” : “http://www.mendeley.
com/documents/?uuid=67c98e03-b473-40b1-9590-2de265ad3205″ } , “mendeley” : { “formattedCitation” : “14”, “plainTextFormattedCitation” : “14”, “previouslyFormattedCitation” : “14” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }14.
2.1Biomineralization ProcessBiomineralization is the process of mineral deposition in particular tissues leading to hardening and stiffening of the mineralized tissue. It occurs in various living organisms, of which are the vertebrates where the deposited mineral is HA. It is a well-orchestrated process of crystal formation within matrix vesicles (MVs) budding from the surface of hypertrophic chondrocytes, osteoblasts and odontoblast and their deposition in between collagen fibrils lying in the extracellular matrix.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1272/jnms.77.
4″, “ISBN” : “1345-4676 (Print)
1345-4676 (Linking)”, “ISSN” : “1347-3409”, “PMID” : “20154452”, “abstract” : “Biomineralization is the process by which hydroxyapatite is deposited in the extracellular matrix. Physiological mineralization occurs in hard tissues, whereas pathological calcification occurs in soft tissues. The first step of mineralization is the formation of hydroxyapatite crystals within matrix vesicles that bud from the surface membrane of hypertrophic chondrocytes, osteoblasts, and odontoblasts. This is followed by propagation of hydroxyapatite into the extracellular matrix and its deposition between collagen fibrils. Extracellular inorganic pyrophosphate, provided by NPP1 and ANKH, inhibits hydroxyapatite formation. Tissue-nonspecific alkaline phosphatase (TNAP) hydrolyzes pyrophosphate and provides inorganic phosphate to promote mineralization.
Inorganic pyrophosphate, pyridoxal phosphate, and phosphoethanolamine are thought to be the physiologic substrates of TNAP. These accumulate in the event of TNAP deficiency, e.g., in cases of hypophosphatasia. The gene encoding TNAP is mapped to chromosome 1, consists of 12 exons, and possesses regulatory motifs in the 5′-untranslated region. Inhibition of TNAP enzymatic activity suppresses TNAP mRNA expression and mineralization in vitro.
Hypophosphatasia is an inherited systemic bone disease characterized by hypomineralization of hard tissues. The phenotype of hypophosphatasia is varied. To date, more than 200 mutations in the TNAP gene have been reported. Knockout mice mimic the phenotypes of severe hypophosphatasia. Among the mutations in the TNAP gene, c.1559delT is frequent in the Japanese population. This frameshift mutation results in the expression of an abnormally long protein that is degraded in cells. DNA-based prenatal diagnosis using chorionic villus sampling has been developed, but requires thorough genetic counseling.
Although hypophosphatasia is untreatable at present, the recent success of enzyme replacement therapy offers promise. The problems presented by impaired mineralization in age-related chronic diseases, such as pathologic calcification and decreasing physiological mineralization are growing in importance. Strategies for preventing pathologic calcification using TNAP and NPP1 are in development. A nutrigenomic approach, based on the relationship between TNAP gene polymorphism and bone mineral density, is also discussed.”, “author” : { “dropping-particle” : “”, “family” : “Orimo”, “given” : “Hideo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Nippon Medical School”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2010” }, “page” : “4-12”, “title” : “The Mechanism of Mineralization and the Role of Alkaline Phosphatase in Health and Disease”, “type” : “article-journal”, “volume” : “77” }, “uris” : “http://www.
mendeley.com/documents/?uuid=6c6e5afb-c73d-41da-af11-b5ba5bf88c3b” } , “mendeley” : { “formattedCitation” : “15”, “plainTextFormattedCitation” : “15”, “previouslyFormattedCitation” : “15” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }15 Recent in vitro studies have shown that MVs are not the exclusive vesicles which function in HA nucleation.
Rather, in various osteoblastic cultures, nucleation occurs within various cell derived structures including in addition to MVs, calcospherulites and biomineralization foci.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.2741/3875”, “ISBN” : “1093-4715 (Electronic)
1093-4715 (Linking)”, “ISSN” : “1093-4715”, “PMID” : “21622198”, “abstract” : “The impact of genetics has dramatically affected our understanding of the functions of non-collagenous proteins. Specifically, mutations and knockouts have defined their cellular spectrum of actions. However, the biochemical mechanisms mediated by non-collagenous proteins in biomineralization remain elusive.
It is likely that this understanding will require more focused functional testing at the protein, cell, and tissue level. Although initially viewed as rather redundant and static acidic calcium binding proteins, it is now clear that non-collagenous proteins in mineralizing tissues represent diverse entities capable of forming multiple protein-protein interactions which act in positive and negative ways to regulate the process of bone mineralization. Several new examples from the author’s laboratory are provided which illustrate this theme including an apparent activating effect of hydroxyapatite crystals on metalloproteinases. This review emphasizes the view that secreted non-collagenous proteins in mineralizing bone actively participate in the mineralization process and ultimately control where and how much mineral crystal is deposited, as well as determining the quality and biomechanical properties of the mineralized matrix produced.
“, “author” : { “dropping-particle” : “”, “family” : “Gorski”, “given” : “Jeffrey Paul”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in bioscience (Landmark edition)”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2011” }, “page” : “2598-621”, “title” : “Biomineralization of bone: a fresh view of the roles of non-collagenous proteins.”, “type” : “article-journal”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=f8c694d1-58f1-4063-91c5-638309cae444” } , “mendeley” : { “formattedCitation” : “16”, “plainTextFormattedCitation” : “16”, “previouslyFormattedCitation” : “16” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.
json” }16 In this manuscript focus will be on MVs because these are the most studied and well defined. MVs are membrane invested vesicles that contain all necessary biochemical machinery required for availability of raw mineralization materials and balancing the inorganic pyrophposphate/ inorganic phosphate (PPi/Pi) ratio. A recent proposed mechanism for mineralization steps include: 1) HA crystals nucleation within MVs, 2) MVs bud from bone (cartilage or dentin) forming cells and interact with collagen fibrils through specific proteins and lipids, 3) MVs rupture and release HA into extracellular matrix (ECM).
ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/978-88-470-5483-7_2”, “ISBN” : “9788847054837”, “author” : { “dropping-particle” : “”, “family” : “Tamma”, “given” : “Roberto”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Carbone”, “given” : “Claudia”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Colucci”, “given” : “Silvia”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Imaging of Prosthetic Joints: A Combined Radiological and Clinical Perspective”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2014” }, “page” : “15-25”, “title” : “Bone matrix proteins and mineralization process”, “type” : “chapter” }, “uris” : “http://www.mendeley.
com/documents/?uuid=aa89fdff-de50-4b58-9f18-6e1211db83c8″ } , “mendeley” : { “formattedCitation” : “17”, “plainTextFormattedCitation” : “17”, “previouslyFormattedCitation” : “17” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }17 Tissue nonspecific alkaline phosphatase (TNAP) is an ectoenzyme linked to MVs membrane by glycosylphosphatidylinositol and function in hydrolysis of PPi providing Pi. ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “0193-1849/01”, “ISBN” : “0896-8608 (Print)
0896-8608 (Linking)”, “ISSN” : “08968608”, “PMID” : “17704434”, “abstract” : “Inorganic pyrophosphate generation and disposition in pathophysiology.
Am J Physiol Cell Physiol 281: C1u2013C11, 2001.u2014Inorganic pyrophosphate (PPi ) regulates certain intracellular functions and extracellular crystal deposition. PPi is produced, degraded, and transported by specialized mechanisms. Moreover, dysregulated cellular PPi production, degradation, and transport all have been asso- ciated with disease, and PPi appears to directly mediate specific disease manifestations. In addition, natural and synthetic analogs of PPi are in use or currently under evaluation as prophylactic agents or therapies for disease. This review summarizes recent developments in the under- standing of how PPi is made and disposed of by cells and assesses the body of evidence for potentially significant physiological functions of intracellular PPi in higher organisms.
Major topics addressed are recent lines of molecular evidence that directly link decreased and increased extracellular PPi levels with diseases in which connective tissue matrix calcification is disordered. To illustrate in depth the effects of disordered PPi metabolism, this review weighs the roles in matrix calcification of the transmembrane protein ANK, which regulates intracellular to extracel- lular movement of PPi , and the PPi-generating phosphodiesterase nucle- otide pyrophosphatase family isoenzyme plasma cell membrane glyco- protein-1″, “author” : { “dropping-particle” : “”, “family” : “Terkeltaub”, “given” : “R A”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Peritoneal Dialysis International”, “id” : “ITEM-1”, “issue” : “281”, “issued” : { “date-parts” : “2001” }, “page” : “C1-C11”, “title” : “Inorganic pyrophosphate generation and disposition in pathophysiology”, “type” : “article”, “volume” : “27” }, “uris” : “http://www.mendeley.com/documents/?uuid=217efc01-1d88-4151-b9f4-7a8d657bcd18” } , “mendeley” : { “formattedCitation” : “18”, “plainTextFormattedCitation” : “18”, “previouslyFormattedCitation” : “18” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.
json” }18PPi inhibit hydroxyapatite formation by binding to these crystals and preventing further growth. PPi is provided by ectonucleotidepyrophoshatase (NPP1) by the hydrolysis of adenosine triphosphate (ATP) preferentially and other nucleoside triphosphates such as guanosine triphosphates (GTP). PPi can also be provided from the membrane transporter: progressive Ankylosis protein homolog (ANKH).
Within MVs Pi are provided by type III sodium/inorganic phosphate (Na/Pi) cotransporter and PHOSPHO1. PHOSPHO1 is a cytosolic phosphatase which cleaves Phosphatidylethanolamine (PE) and Phosphatidylcholine (PC) releasing Pi.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1016/j.
bone.2003.12.023″, “ISBN” : “8756-3282 (Print)
1873-2763 (Linking)”, “ISSN” : “87563282”, “PMID” : “15050893”, “abstract” : “Mineralisation of bone and cartilage is essential for skeletal development and function. We have previously reported a novel gene (PHOSPHO1); a member of the large haloacid dehalogenase superfamily of hydrolases which has an active site indicative of a phosphatase. Its high expression in skeletal tissues has led us to speculate that PHOSPHO1 may be involved in the mineralisation process.
Therefore, in this study, we have determined that PHOSPHO1 is localized to sites of mineralisation in both cartilage and bone. Recombinant derived PHOSPHO1 protein was produced and affinity purified PHOSPHO1 antiserum was generated and used to immunostain a range of skeletal and soft avian tissues. In addition, PHOSPHO1 gene expression was determined in SaOS-2 and MG-63 osteoblast-like cells by RT-PCR. In diaphyseal cortical bone, immunohistochemistry localized PHOSPHO1 protein to the osteoid layer of the periosteum, forming surfaces of growing osteons, and newly formed osteocytes, whereas the endosteum and closed osteons were negative. In growth plate cartilage, immunoreactivity was limited to the early hypertrophic chondrocytes and the ossification groove of Ranvier. Cartilage remnants and trabecular bone within the primary spongiosa exhibited strong immunoreactivity on their mineralising surfaces. In 17-day-old embryonic calvaria, the osteoid present on the intramembranous and periosteal bone surfaces stained positively for PHOSPHO1.
All soft tissues examined were negative. PHOSPHO1 gene expression was detected in mineralising SaOS-2 but not in the non-mineralising MG-63 osteoblast-like cells and gene expression levels were unchanged by dexamethasone, estradiol, 1,25-dihydroxyvitamin D3 or PTHrP treatment. Western analysis of chick growth plate cell lysate yielded bands (30.4 and 28.
6 kD) corresponding to transcripts initiated at each of two possible initiation codons indicating the presence of alternative transcripts for PHOSPHO1 in growth cartilage. These results confirm that the PHOSPHO1 protein and gene expression profile is consistent with a role for PHOSPHO1 in bone and cartilage matrix mineralisation. ?? 2004 Elsevier Inc. All rights reserved.”, “author” : { “dropping-particle” : “”, “family” : “Houston”, “given” : “Brian”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Stewart”, “given” : “Alan J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Farquharson”, “given” : “Colin”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Bone”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2004” }, “page” : “629-637”, “title” : “PHOSPHO1 – A novel phosphatase specifically expressed at sites of mineralisation in bone and cartilage”, “type” : “article-journal”, “volume” : “34” }, “uris” : “http://www.
mendeley.com/documents/?uuid=bcc7f4ff-2cdf-4e91-94c0-36c826eaf375″ } , “mendeley” : { “formattedCitation” : “19”, “plainTextFormattedCitation” : “19”, “previouslyFormattedCitation” : “19” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }19 The internal layer of MVs is rich in phosphatidylserine, a lipid with high affinity for both calcium and phosphate. MVs have the ability of interaction with collagen type II and X mediated by membrane bound annexin A5 (AnxA5) which are Ca2+ and phospholipid binding proteins stimulating Ca2+ influx into the vesicles.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “author” : { “dropping-particle” : “”, “family” : “Pikula”, “given” : “Slawomir”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2016” }, “page” : “511-517”, “title” : “Membranes and pathophysiological mineralization”, “type” : “article-journal”, “volume” : “62” }, “uris” : “http://www.mendeley.com/documents/?uuid=cadd51a2-25b6-4835-9e66-38437d6a74c9” } , “mendeley” : { “formattedCitation” : “20”, “plainTextFormattedCitation” : “20”, “previouslyFormattedCitation” : “20” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.
com/citation-style-language/schema/raw/master/csl-citation.json” }20 The process is mediated by the action of several molecules and steps making it highly regulated and complex(Figure 1). 895985883920Ectopic expression of TNAP is a very imortant factor behind pathological calciification knowing that TNAP and collagen type I proteins are sufficient for triggering extracellular matrix mineralization.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “author” : { “dropping-particle” : “”, “family” : “Pikula”, “given” : “Slawomir”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2016” }, “page” : “511-517”, “title” : “Membranes and pathophysiological mineralization”, “type” : “article-journal”, “volume” : “62” }, “uris” : “http://www.mendeley.com/documents/?uuid=cadd51a2-25b6-4835-9e66-38437d6a74c9” } , “mendeley” : { “formattedCitation” : “20”, “plainTextFormattedCitation” : “20”, “previouslyFormattedCitation” : “20” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.
json” }20 Figure 1: Schematic illustration of the process of mineralization.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1272/jnms.77.4”, “ISBN” : “1345-4676 (Print)
1345-4676 (Linking)”, “ISSN” : “1347-3409”, “PMID” : “20154452”, “abstract” : “Biomineralization is the process by which hydroxyapatite is deposited in the extracellular matrix. Physiological mineralization occurs in hard tissues, whereas pathological calcification occurs in soft tissues. The first step of mineralization is the formation of hydroxyapatite crystals within matrix vesicles that bud from the surface membrane of hypertrophic chondrocytes, osteoblasts, and odontoblasts. This is followed by propagation of hydroxyapatite into the extracellular matrix and its deposition between collagen fibrils. Extracellular inorganic pyrophosphate, provided by NPP1 and ANKH, inhibits hydroxyapatite formation. Tissue-nonspecific alkaline phosphatase (TNAP) hydrolyzes pyrophosphate and provides inorganic phosphate to promote mineralization. Inorganic pyrophosphate, pyridoxal phosphate, and phosphoethanolamine are thought to be the physiologic substrates of TNAP. These accumulate in the event of TNAP deficiency, e.g., in cases of hypophosphatasia. The gene encoding TNAP is mapped to chromosome 1, consists of 12 exons, and possesses regulatory motifs in the 5′-untranslated region. Inhibition of TNAP enzymatic activity suppresses TNAP mRNA expression and mineralization in vitro. Hypophosphatasia is an inherited systemic bone disease characterized by hypomineralization of hard tissues. The phenotype of hypophosphatasia is varied. To date, more than 200 mutations in the TNAP gene have been reported. Knockout mice mimic the phenotypes of severe hypophosphatasia. Among the mutations in the TNAP gene, c.1559delT is frequent in the Japanese population. This frameshift mutation results in the expression of an abnormally long protein that is degraded in cells. DNA-based prenatal diagnosis using chorionic villus sampling has been developed, but requires thorough genetic counseling. Although hypophosphatasia is untreatable at present, the recent success of enzyme replacement therapy offers promise. The problems presented by impaired mineralization in age-related chronic diseases, such as pathologic calcification and decreasing physiological mineralization are growing in importance. Strategies for preventing pathologic calcification using TNAP and NPP1 are in development. A nutrigenomic approach, based on the relationship between TNAP gene polymorphism and bone mineral density, is also discussed.”, “author” : { “dropping-particle” : “”, “family” : “Orimo”, “given” : “Hideo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Nippon Medical School”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2010” }, “page” : “4-12”, “title” : “The Mechanism of Mineralization and the Role of Alkaline Phosphatase in Health and Disease”, “type” : “article-journal”, “volume” : “77” }, “uris” : “http://www.mendeley.com/documents/?uuid=6c6e5afb-c73d-41da-af11-b5ba5bf88c3b” } , “mendeley” : { “formattedCitation” : “15”, “plainTextFormattedCitation” : “15”, “previouslyFormattedCitation” : “15” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }152.2.Bone and Cartilage proteins: Runx2, OPN, OCN, MGPAs previously mentioned the process of calcification is highly similar to biomineralization and associated with imbalance of stimulators and inhibitors, Herein are some examples of most studied critical markers, their mechanism of action, and how their level of expression is modified in VC.(Table 1)Runt-related transcription factor 2 (Runx 2) also known as core-binding factor subunit alpha-1 (Cbfa1) is the first transcription factor involved in mesenchymal stem cell differentiation into osteoblastic lineage. It also bind to the promoter or enhancer sequence of several bone matrix protein genes includingSpp1 (encoding for OPN) and Bglap (encoding OCN) and thus acting as a master regulator required for bone development. Osterix is another transcription factor required for osteoblastic differentiationADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1002/biof.72.Regulation”, “ISBN” : “1872-8081 (Electronic) 0951-6433 (Linking)”, “ISSN” : “1872-8081”, “PMID” : “20087883”, “abstract” : “In recent years, much progress has been made in understanding the factors that regulate the gene expression program that underlies the induction, proliferation, differentiation and maturation of osteoblasts. A large and growing number of transcription factors make important contributions to the precise control of osteoblast formation and function. It has become increasingly clear that these diverse transcription factors and the signals that regulate their activity cannot be viewed as discrete, separate signaling pathways. Rather, they form a highly interconnected, cooperative network that permits gene expression to be closely regulated. There has also been a substantial increase in our understanding of the mechanistic control of gene expression by co-factors such as acetyltransferases and histone deacetylases. The purpose of this review is to highlight recent progress in understanding the major transcription factors and associated epigenetic co-regulators involved in osteoblastogenesis and the mechanisms that determine their functions as regulators of gene expression”, “author” : { “dropping-particle” : “”, “family” : “Jensen”, “given” : “”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Gopalakrishnan”, “given” : “”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Westendorf”, “given” : “Jennifer J”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Biofactors”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2010” }, “page” : “25-32”, “title” : “Regulation of Gene Expression in Osteoblasts”, “type” : “article-journal”, “volume” : “36” }, “uris” : “http://www.mendeley.com/documents/?uuid=a9dc6ddf-dc92-4a32-88b3-1a8d8fbfff53” } , “mendeley” : { “formattedCitation” : “21”, “plainTextFormattedCitation” : “21”, “previouslyFormattedCitation” : “21” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }21. In osterix-null mice no bone formation occurs suggesting that osterix act downstream Runx-2.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1002/jcb.24439”, “ISBN” : “0730-2312”, “ISSN” : “07302312”, “PMID” : “23225263”, “abstract” : “Osteoblast differentiation is a multi-step process where mesenchymal cells differentiate into osteoblast lineage cells including osteocytes. Osterix (Osx) is an osteoblast-specific transcription factor which activates a repertoire of genes during differentiation of preosteoblasts into mature osteoblasts and osteocytes. The essential role of Osx in the genetic program of bone formation and in bone homeostasis is well established. Osx mutant embryos do not form bone and fail to express osteoblast-specific marker genes. Inactivation of Osx in mice after birth causes multiple skeletal phenotypes including lack of new bone formation, absence of resorption of mineralized cartilage, and defects in osteocyte maturation and function. Since Osx is a major effector in skeletal formation, studies on Osx gained momentum over the last 5-7 years and implicated its important function in tooth formation as well as in healing of bone fractures. This review outlines mouse genetic studies that establish the essential role of Osx in bone and tooth formation as well as in healing of bone fractures. We also discuss the recent advances in regulation of Osx expression, which is under control of a transcriptional network, signaling pathways, and epigenetic regulation. Finally, we summarize important findings on the positive and negative regulation of Osx’s transcriptional activity through protein-protein interactions in expression of its target genes during osteoblast differentiation. In particular, the identification of the histone demethylase NO66 as an Osx-interacting protein, which negatively regulates Osx activity opens further avenues in studying epigenetic control of Osx target genes during differentiation and maturation of osteoblasts.”, “author” : { “dropping-particle” : “”, “family” : “Sinha”, “given” : “Krishna M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Zhou”, “given” : “Xin”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Cellular Biochemistry”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2013” }, “page” : “975-984”, “title” : “Genetic and molecular control of osterix in skeletal formation”, “type” : “article-journal”, “volume” : “114” }, “uris” : “http://www.mendeley.com/documents/?uuid=2962368f-e9b4-4de9-9590-35a7d3444ab3” } , “mendeley” : { “formattedCitation” : “22”, “plainTextFormattedCitation” : “22”, “previouslyFormattedCitation” : “22” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }22 Runx 2 expressions has been identified in calcifying aortic SMC and atherosclerotic specimens.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/01.ATV.0000059406.92165.31”, “ISBN” : “1524-4636 (Electronic)”, “ISSN” : “10795642”, “PMID” : “12615658”, “abstract” : “OBJECTIVE: Mineralization-regulating proteins are found deposited at sites of vascular calcification. However, the relationship between the onset of calcification in vivo and the expression of genes encoding mineralization-regulating proteins is unknown. This study aimed to determine the temporal and spatial pattern of expression of key bone and cartilage proteins as atherosclerotic calcification progresses.
METHODS AND RESULTS: Using reverse transcription-polymerase chain reaction on a panel of noncalcified and calcified human arterial samples, two classes of proteins could be identified: (1) Matrix Gla protein, osteonectin, osteoprotegerin, and aggrecan were constitutively expressed by vascular smooth muscle cells (VSMCs) in the normal vessel media but downregulated in calcified arteries whereas (2) alkaline phosphatase, bone sialoprotein, osteocalcin, and collagen II were expressed predominantly in the calcified vessel together with Cbfa1, Msx2, and Sox9, transcription factors that regulate expression of these genes. In the calcified plaque in situ hybridization identified subsets of VSMCs expressing osteoblast and chondrocyte-like gene expression profiles whereas osteoclast-like macrophages were present around sites of calcification.
CONCLUSIONS: These observations suggest a sequence of molecular events in vascular calcification beginning with the loss of expression by VSMCs, of constitutive inhibitory proteins, and ending with expression by VSMCs and macrophages of chondrocytic, osteoblastic, and osteoclastic-associated proteins that orchestrate the calcification process.”, “author” : { “dropping-particle” : “”, “family” : “Tyson”, “given” : “Kerry L.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Reynolds”, “given” : “Joanne L.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “McNair”, “given” : “Rosamund”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Zhang”, “given” : “Qiuping”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Weissberg”, “given” : “Peter L.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shanahan”, “given” : “Catherine M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Arteriosclerosis, Thrombosis, and Vascular Biology”, “id” : “ITEM-1”, “issue” : “3”, “issued” : { “date-parts” : “2003” }, “page” : “489-494”, “title” : “Osteo/chondrocytic transcription factors and their target genes exhibit distinct patterns of expression in human arterial calcification”, “type” : “article-journal”, “volume” : “23” }, “uris” : “http://www.mendeley.com/documents/?uuid=9fbdb105-ea9c-4566-a6f2-2767bc3dc53f” } , “mendeley” : { “formattedCitation” : “23”, “plainTextFormattedCitation” : “23”, “previouslyFormattedCitation” : “23” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }23 H2O2 induced VSMC calcification was associated with an increase in mRNA and protein level of Runx2.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1074/jbc.M800021200”, “ISBN” : “0021-9258”, “ISSN” : “0021-9258”, “abstract” : “Oxidative stress plays a critical role in the pathogenesis of atherosclerosis including the formation of lipid laden macrophages and the development of inflammation. However, oxidative stress-induced molecular signaling that regulates the development of vascular calcification has not been investigated in depth. Osteogenic differentiation of vascular smooth muscle cells (VSMC) is critical in the development of calcification in atherosclerotic lesions. An important contributor to oxidative stress in atherosclerotic lesions is the formation of hydrogen peroxide from diverse sources in vascular cells. In this study we defined molecular signaling that is operative in the H2O2-induced VSMC calcification. We found that H2O2 promotes a phenotypic switch of VSMC from contractile to osteogenic phenotype. This response was associated with an increased expression and transactivity of Runx2, a key transcription factor for osteogenic differentiation. The essential role of Runx2 in oxidative stress-induced VSMC calcification was further confirmed by Runx2 depletion and overexpression. Inhibition of Runx2 using short hairpin RNA blocked VSMC calcification, and adenovirus-mediated overexpression of Runx2 alone induced VSMC calcification. Inhibition of H2O2-activated AKT signaling blocked VSMC calcification and Runx2 induction concurrently. This blockage did not cause VSMC apoptosis. Taken together, our data demonstrate a critical role for AKT-mediated induction of Runx2 in oxidative stress-induced VSMC calcification.”, “author” : { “dropping-particle” : “”, “family” : “Byon”, “given” : “C H”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Javed”, “given” : “A”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Dai”, “given” : “Q”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kappes”, “given” : “J C”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Clemens”, “given” : “T L”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Darley-Usmar”, “given” : “V M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “McDonald”, “given” : “J M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Chen”, “given” : “Y”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Biological Chemistry”, “id” : “ITEM-1”, “issue” : “22”, “issued” : { “date-parts” : “2008” }, “page” : “15319-15327”, “title” : “Oxidative stress induces vascular calcification through modulation of the osteogenic transcription factor Runx2 by AKT signaling”, “type” : “article-journal”, “volume” : “283” }, “uris” : “http://www.mendeley.com/documents/?uuid=ebcf4fb2-bab4-48e9-be39-0455cae0b531” } , “mendeley” : { “formattedCitation” : “24”, “plainTextFormattedCitation” : “24”, “previouslyFormattedCitation” : “24” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }24 Moreover VSMC Runx-2 expression was indispensable for inducing arterial medial calcification by vitamin D.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1016/j.ajpath.2015.03.020”, “ISBN” : “1525-2191 (Electronic)
0002-9440 (Linking)”, “ISSN” : “15252191”, “PMID” : “25987250”, “abstract” : “Arterial medial calcification (AMC) is a hallmark of aging, diabetes, and chronic kidney disease. Smooth muscle cell (SMC) transition to an osteogenic phenotype is a common feature of AMC, and is preceded by expression of runt-related transcription factor 2 (Runx2), a master regulator of bone development. Whether SMC-specific Runx2 expression is required for osteogenic phenotype change and AMC remains unknown. We therefore created an improved targeting construct to generate mice with floxed Runx2 alleles (Runx2f/f) that do not produce truncated Runx2 proteins after Cre recombination, thereby preventing potential off-target effects. SMC-specific deletion using SM22-recombinase transgenic allele mice (Runx2u0394SM) led to viable mice with normal bone and arterial morphology. After vitamin D overload, arterial SMCs in Runx2f/f mice expressed Runx2, underwent osteogenic phenotype change, and developed severe AMC. In contrast, vitamin D-treated Runx2u0394SM mice had no Runx2 in blood vessels, maintained SMC phenotype, and did not develop AMC. Runx2 deletion did not affect serum calcium, phosphate, fibroblast growth factor-23, or alkaline phosphatase levels. In vitro, Runx2f/f SMCs calcified to a much greater extent than those derived from Runx2u0394SM mice. These data indicate a critical role of Runx2 in SMC osteogenic phenotype change and mineral deposition in a mouse model of AMC, suggesting that Runx2 and downstream osteogenic pathways in SMCs may be useful therapeutic targets for treating or preventing AMC in high-risk patients.”, “author” : { “dropping-particle” : “”, “family” : “Lin”, “given” : “Mu En”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Chen”, “given” : “Theodore”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Leaf”, “given” : “Elizabeth M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Speer”, “given” : “Mei Y.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Giachelli”, “given” : “Cecilia M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “American Journal of Pathology”, “id” : “ITEM-1”, “issue” : “7”, “issued” : { “date-parts” : “2015” }, “page” : “1958-1969”, “title” : “Runx2 Expression in Smooth Muscle Cells Is Required for Arterial Medial Calcification in Mice”, “type” : “article-journal”, “volume” : “185” }, “uris” : “http://www.mendeley.com/documents/?uuid=5fd656aa-f61b-43ee-8f07-5011c3b3b72d” } , “mendeley” : { “formattedCitation” : “25”, “plainTextFormattedCitation” : “25”, “previouslyFormattedCitation” : “25” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }25OPN also known as bone sialoprotein 1(BSP-1) is a multifunctional acidic non-collagenous bone matrix protein secreted by the osteoclast and osteoblast. It is present in human plasma, serum, breast milk and urine.OPN is a cytokine released by macrophages, neutrophils, and dendritic cells which increase INF-? and IL-12 level of expression and is important for Th1 cells activity.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1093/qjmed/95.1.3”, “ISBN” : “1460-2725 (Print)
1460-2393 (Linking)”, “ISSN” : “14602393”, “PMID” : “11834767”, “abstract” : “Introduction Osteopontin (OPN) is a multifunctional protein, and although highly expressed in bone, it is also expressed by various cell types including macrophages, endothelial cells, smooth muscle cells and epithelial cells.1,,2 OPN is involved in diverse biological processes and the aim of this review is to give a broad outline of some important aspects of the biology of OPN. Although this review is written primarily from a renal perspective, it is hoped that the reader will appreciate that OPN is involved in both physiological and pathological processes in multiple organs and tissues including biomineralization, inflammation, leukocyte recruitment and cell survival. OPN structure OPN is a negativelyu2010charged acidic hydrophilic protein of approximately 300 amino acid residues, and is secreted into all body fluids. The OPN cDNA from various mammalian species exhibits a high degree of sequence homology. There is evidence of alternative splicing, although the functional significance of this is unclear at present. The molecule undergoes considerable postu2010translational modification, and is phosphorylated and glycosylated. OPN has an arginineu2010glycineu2010aspartic acid (RGD) cell binding sequence, a calcium binding site and two heparin binding domains. Cells may bind OPN via multiple integrin receptors including the vitronectin receptor (u03b1vu03b23) as well as various u03b21 and u03b25 integrins. Integrin binding may be RGDu2010dependent or u2010independent (e.g. via the motif SVVYGLR). OPN does not bind the standard form of CD44 (hyaluronic acid receptor) but does bind various isoforms of CD44. These CD44 isoforms bind OPN via multiple sites. OPN may be cleaved by thrombin, resulting in the exposure of additional cryptic binding sites as well as the production of functional chemotactic fragments.3 Regulation of OPN expression The regulation of OPN expression is incompletely understood at present and may differ between various cell types. Studies indicate that the OPN promoter contains various motifs including a purineu2010rich u2026”, “author” : { “dropping-particle” : “”, “family” : “Mazzali”, “given” : “M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “QJM”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2002” }, “page” : “3-13”, “title” : “Osteopontin–a molecule for all seasons”, “type” : “article-journal”, “volume” : “95” }, “uris” : “http://www.mendeley.com/documents/?uuid=003917d5-7c45-4523-93b1-5ac4a97759e7” } , “mendeley” : { “formattedCitation” : “26”, “plainTextFormattedCitation” : “26”, “previouslyFormattedCitation” : “26” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }26 During normal bone mineralization, OPN release is induced and function in inhibition of HA formation. It also functions in linking osteoclasts and osteoblasts to matrix proteins in bone.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/ATVBAHA.107.144824”, “ISBN” : “1524-4636 (Electronic)
1079-5642 (Linking)”, “ISSN” : “10795642”, “PMID” : “17717292”, “abstract” : “Osteopontin (OPN) is a multifunctional molecule highly expressed in chronic inflammatory and autoimmune diseases, and it is specifically localized in and around inflammatory cells. OPN is a secreted adhesive molecule, and it is thought to aid in the recruitment of monocytes-macrophages and to regulate cytokine production in macrophages, dendritic cells, and T-cells. OPN has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically OPN is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Clinically, OPN plasma levels have been found associated with various inflammatory diseases, including cardiovascular burden. It is thus imperative to dissect the OPN proinflammatory and anticalcific functions. OPN recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. However, the integrin receptors and intracellular pathways mediating OPN effects on immune cells are not well established. Furthermore, several studies show that OPN is cleaved by at least 2 classes of proteases: thrombin and matrix-metalloproteases (MMPs). Most importantly, at least in vitro, fragments generated by cleavage not only maintain OPN adhesive functions but also expose new active domains that may impart new activities. The role for OPN proteolytic fragments in vivo is almost completely unexplored. We believe that further knowledge of the effects of OPN fragments on cell responses might help in designing therapeutics targeting inflammatory and cardiovascular diseases.”, “author” : { “dropping-particle” : “”, “family” : “Scatena”, “given” : “Marta”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Liaw”, “given” : “Lucy”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Giachelli”, “given” : “Cecilia M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Arteriosclerosis, Thrombosis, and Vascular Biology”, “id” : “ITEM-1”, “issue” : “11”, “issued” : { “date-parts” : “2007” }, “page” : “2302-2309”, “title” : “Osteopontin: A multifunctional molecule regulating chronic inflammation and vascular disease”, “type” : “article”, “volume” : “27” }, “uris” : “http://www.mendeley.com/documents/?uuid=0c321c7a-3693-46e4-a53e-d1e19737dd43” } , “mendeley” : { “formattedCitation” : “27”, “plainTextFormattedCitation” : “27”, “previouslyFormattedCitation” : “27” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }27 OPN plays important pathological roles in several diseases including cancer and cardiovascular calcification. In initial stages of calcification, together with osteocalcin, OPN is not released markedly however its level of expression increases significantly in advanced stages of the disease suggesting that it has no role in initial arterial calcification.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/ATVBAHA.107.144824”, “ISBN” : “1524-4636 (Electronic)
1079-5642 (Linking)”, “ISSN” : “10795642”, “PMID” : “17717292”, “abstract” : “Osteopontin (OPN) is a multifunctional molecule highly expressed in chronic inflammatory and autoimmune diseases, and it is specifically localized in and around inflammatory cells. OPN is a secreted adhesive molecule, and it is thought to aid in the recruitment of monocytes-macrophages and to regulate cytokine production in macrophages, dendritic cells, and T-cells. OPN has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically OPN is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Clinically, OPN plasma levels have been found associated with various inflammatory diseases, including cardiovascular burden. It is thus imperative to dissect the OPN proinflammatory and anticalcific functions. OPN recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. However, the integrin receptors and intracellular pathways mediating OPN effects on immune cells are not well established. Furthermore, several studies show that OPN is cleaved by at least 2 classes of proteases: thrombin and matrix-metalloproteases (MMPs). Most importantly, at least in vitro, fragments generated by cleavage not only maintain OPN adhesive functions but also expose new active domains that may impart new activities. The role for OPN proteolytic fragments in vivo is almost completely unexplored. We believe that further knowledge of the effects of OPN fragments on cell responses might help in designing therapeutics targeting inflammatory and cardiovascular diseases.”, “author” : { “dropping-particle” : “”, “family” : “Scatena”, “given” : “Marta”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Liaw”, “given” : “Lucy”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Giachelli”, “given” : “Cecilia M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Arteriosclerosis, Thrombosis, and Vascular Biology”, “id” : “ITEM-1”, “issue” : “11”, “issued” : { “date-parts” : “2007” }, “page” : “2302-2309”, “title” : “Osteopontin: A multifunctional molecule regulating chronic inflammation and vascular disease”, “type” : “article”, “volume” : “27” }, “uris” : “http://www.mendeley.com/documents/?uuid=0c321c7a-3693-46e4-a53e-d1e19737dd43” } , “mendeley” : { “formattedCitation” : “27”, “plainTextFormattedCitation” : “27”, “previouslyFormattedCitation” : “27” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }27OCN is the most abundant non-collagenous protein in the bone matrix solely released by the osteoblast.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.2741/3875”, “ISBN” : “1093-4715 (Electronic)
1093-4715 (Linking)”, “ISSN” : “1093-4715”, “PMID” : “21622198”, “abstract” : “The impact of genetics has dramatically affected our understanding of the functions of non-collagenous proteins. Specifically, mutations and knockouts have defined their cellular spectrum of actions. However, the biochemical mechanisms mediated by non-collagenous proteins in biomineralization remain elusive. It is likely that this understanding will require more focused functional testing at the protein, cell, and tissue level. Although initially viewed as rather redundant and static acidic calcium binding proteins, it is now clear that non-collagenous proteins in mineralizing tissues represent diverse entities capable of forming multiple protein-protein interactions which act in positive and negative ways to regulate the process of bone mineralization. Several new examples from the author’s laboratory are provided which illustrate this theme including an apparent activating effect of hydroxyapatite crystals on metalloproteinases. This review emphasizes the view that secreted non-collagenous proteins in mineralizing bone actively participate in the mineralization process and ultimately control where and how much mineral crystal is deposited, as well as determining the quality and biomechanical properties of the mineralized matrix produced.”, “author” : { “dropping-particle” : “”, “family” : “Gorski”, “given” : “Jeffrey Paul”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in bioscience (Landmark edition)”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2011” }, “page” : “2598-621”, “title” : “Biomineralization of bone: a fresh view of the roles of non-collagenous proteins.”, “type” : “article-journal”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=f8c694d1-58f1-4063-91c5-638309cae444” } , “mendeley” : { “formattedCitation” : “16”, “plainTextFormattedCitation” : “16”, “previouslyFormattedCitation” : “16” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }16 Its precise function in bone metabolism is not fully elucidated. It has long been known for its negative role in bone formation and used as a clinical marker for bone turnover. Surprisingly, osteocalcin deficient mice do not suffer from skeletal abnormalities or have a change in bone mineralization or resorption.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1038/382448a0”, “ISBN” : “0028-0836 (Print)”, “ISSN” : “0028-0836”, “PMID” : “8684484”, “abstract” : “Vertebrates constantly remodel bone. The resorption of preexisting bone by osteoclasts and the formation of new bone by osteoblasts is strictly coordinated to maintain bone mass within defined limits. A few molecular determinants of bone remodelling that affect osteoclast activity have been characterized, but the molecular determinants of osteoblast activity are unknown. To investigate the role of osteocalcin, the most abundant osteoblast-specific non-collagenous protein, we have generated osteocalcin-deficient mice. These mice develop a phenotype marked by higher bone mass and bones of improved functional quality. Histomorphometric studies done before and after ovariectomy showed that the absence of osteocalcin leads to an increase in bone formation without impairing bone resorption. To our knowledge, this study provides the first evidence that osteocalcin is a determinant of bone formation.”, “author” : { “dropping-particle” : “”, “family” : “Ducy”, “given” : “Patricia”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Desbois”, “given” : “Christelle”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Boyce”, “given” : “Brendan”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Pinero”, “given” : “Gerald”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Story”, “given” : “Beryl”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Dunstan”, “given” : “Colin”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Smith”, “given” : “Erica”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bonadio”, “given” : “Jeffrey”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Goldstein”, “given” : “Steven”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Gundberg”, “given” : “Caren”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bradley”, “given” : “Allan”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Karsenty”, “given” : “Gerard”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nature”, “id” : “ITEM-1”, “issue” : “6590”, “issued” : { “date-parts” : “1996” }, “page” : “448-452”, “title” : “Increased bone formation in osteocalcin-deficient mice”, “type” : “article-journal”, “volume” : “382” }, “uris” : “http://www.mendeley.com/documents/?uuid=84408c93-3286-4f53-b710-4c67313dbbfb” } , “mendeley” : { “formattedCitation” : “28”, “plainTextFormattedCitation” : “28”, “previouslyFormattedCitation” : “28” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }28 Matrix Gla Protein (MGP) is a vitamin k-dependent protein expressed in bone and vessels. Together with osteocalcin, MGP has glutamate residues that need to be ?-carboxylated to activate them in a reaction that requires vitamin K. This explains why individuals with vitamin K deficiency are prone to VC. One of the mechanisms proposed to inhibit medial calcification is by chelating calcium ions and inhibiting crystals growth. An alternative mechanism is binding to BMP-2 and inactivating it, ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “ISBN” : “0340-6245 (Print)
0340-6245 (Linking)”, “ISSN” : “0340-6245”, “PMID” : “11154111”, “abstract” : “Matrix Gla protein (MGP) is an inhibitor of calcification of the arterial wall but the mechanism of inhibition has not been resolved. Since chondrogenesis has been identified in calcified arteries from MPG null mice, we hypothesized that locally produced MGP might inhibit calcification by neutralizing the known effect of bone morphogenetic proteins (BMPs) as promotors of chondrogenesis and bone formation. As the first step to test this hypothesis, we demonstrate that MGP is a binding protein for 125I-BMP-2. Optimal binding is dependent on metals which suggests that the metal binding Gla region in MGP is involved. MGP is shown to undergo a Ca++ induced conformational change despite the presence of the gamma-carboxylase binding site being part of the mature protein sequence. The data propose that MGP matures earlier in the secretory pathway than other vitamin K-dependent proteins. Antibodies were used in an attempt to identify MGP in bovine serum. Conformational specific MGP antibodies were shown to also recognize the Gla region in prothrombin and factor X but did not identify MGP in serum. This finding is supported by electrophoresis data which demonstrate the absence of MGP among Ba-citrate absorbed vitamin K-dependent serum proteins. We conclude that MGP does not exist in normal bovine serum.”, “author” : { “dropping-particle” : “”, “family” : “Wallin”, “given” : “R”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Cain”, “given” : “D”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Hutson”, “given” : “S M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Sane”, “given” : “D C”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Loeser”, “given” : “R”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Thrombosis and haemostasis”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2000” }, “page” : “1039-44”, “title” : “Modulation of the binding of matrix Gla protein (MGP) to bone morphogenetic protein-2 (BMP-2).”, “type” : “article-journal”, “volume” : “84” }, “uris” : “http://www.mendeley.com/documents/?uuid=b981fa79-41e8-409b-b17a-ba9dac44be68” } , “mendeley” : { “formattedCitation” : “29”, “plainTextFormattedCitation” : “29”, “previouslyFormattedCitation” : “29” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }29 the transcription factor required for osteogenic differentiation rats treated with warfarin develop medial VC and MGP-/- mice suffer from severe calcificationADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/01.ATV.18.9.1400”, “ISBN” : “1079-5642 (Print)”, “ISSN” : “1079-5642”, “PMID” : “9743228”, “abstract” : “High doses of warfarin cause focal calcification of the elastic lamellae in the media of major arteries and in aortic heart valves in the rat. Aortic calcification was first seen after 2 weeks of warfarin treatment and progressively increased in density at 3, 4, and 5 weeks of treatment. By 5 weeks, the highly focal calcification of major arteries could be seen on radiographs and by visual inspection of the artery. The calcification of arteries induced by warfarin is similar to that seen in the matrix Gla protein (MGP)-deficient mouse, which suggests that warfarin induces artery calcification by inhibiting gamma-carboxylation of MGP and thereby inactivating the putative calcification-inhibitory activity of the protein. Warfarin treatment markedly increased the levels of MGP mRNA and protein in calcifying arteries and decreased the level of MGP in serum. Warfarin treatment did not affect bone growth, overall weight gain, or serum calcium and phosphorus levels, and, because of the concurrent administration of vitamin K, prothrombin times and hematocrits were normal. The results indicate that the improved warfarin plus vitamin K treatment protocol developed in this study should provide a useful model to investigate the role of MGP in preventing calcification of arteries and heart valves.”, “author” : { “dropping-particle” : “”, “family” : “Price”, “given” : “P a”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Faus”, “given” : “S a”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Williamson”, “given” : “M K”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Arteriosclerosis, thrombosis, and vascular biology”, “id” : “ITEM-1”, “issue” : “9”, “issued” : { “date-parts” : “1998” }, “page” : “1400-1407”, “title” : “Warfarin causes rapid calcification of the elastic lamellae in rat arteries and heart valves.”, “type” : “article-journal”, “volume” : “18” }, “uris” : “http://www.mendeley.com/documents/?uuid=2cddd188-23ab-4b58-a116-da560eddd998” } , “mendeley” : { “formattedCitation” : “30”, “plainTextFormattedCitation” : “30”, “previouslyFormattedCitation” : “30” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }30. High doses of vitamin D induce vascular calcification by increasing serum calcium and phosphate, the formation of Fetuin-A mineral complexes in association with a decrease in free serum levels of Fetuin-A or by MGP is downregulation. ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1159/000299794”, “ISBN” : “1421-9670 (Electronic)
0250-8095 (Linking)”, “ISSN” : “1460-2385”, “PMID” : “20413965”, “abstract” : “Vascular calcification is a significant contributor to the cardiovascular mortality observed in chronic kidney disease (CKD). This review discusses the animal models (5/6 nephrectomy, mouse electrocautery model and dietary adenine) that have been employed in the study of vascular calcification outcomes in CKD. Rodent models of CKD generate a range of severity in the vascular calcification phenotype. Major limitations of the 5/6th nephrectomy model include the requirement for surgery and the need to use either excessive dietary phosphorus or vitamin D. Major limitations of the mouse electrocautery model include the requirement for surgery, the mortality rate when very advanced CKD develops, and resistance to vascular calcification without the use of transgenic animals. This is balanced against the major advantage of the ability to study transgenic animals to further understand the mechanisms associated with either the acceleration or inhibition of calcification. Dietary adenine generates severe CKD and does not require surgery. The major disadvantage is the weight loss that ensues when rats receive a diet containing 0.75% adenine. In summary, animal models are useful to study CKD-associated vascular calcification and the results obtained in these pre-clinical animal studies appear to translate to the evidence, however limited, which exists in humans with CKD.”, “author” : { “dropping-particle” : “”, “family” : “Hsu”, “given” : “Jeffrey J”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Tintut”, “given” : “Yin”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Demer”, “given” : “Linda L”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shobeiri”, “given” : “Navid”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Adams”, “given” : “Michael A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Holden”, “given” : “Rachel M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Dru00fceke”, “given” : “Tilman B”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Massy”, “given” : “Ziad a”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “American Journal of Nephrology”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2010” }, “page” : “1704-7”, “title” : “Role of vitamin D in vascular calcification: bad guy or good guy?”, “type” : “article-journal”, “volume” : “27” }, “uris” : “http://www.mendeley.com/documents/?uuid=ce690c8c-fdb9-4334-ba8e-88a17ad183e3” } , “mendeley” : { “formattedCitation” : “9”, “plainTextFormattedCitation” : “9”, “previouslyFormattedCitation” : “9” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }9Biomarker Mechanism of action Effect on VCRunx-2,osterix Transcription factor for osteoblast differentiation from mesenchymal stem cell precursor Promotes calcificationOPN Binds hydroxyapatite and blocks its growth, inhibits VSMC mineralization Inhibits VC*OCN Binds strongly apatite and calcium, prevents calcium precipitation Associated with VC*OPG A decoy receptor for RANKL, interferes with RANK/RANKL interaction Inhibit VCSclerostin Inhibits osteoblast mediated bone formation(through inhibition of Wnt signaling) Inhibits VCBMP-2 Promotes osteoblast differentiation Promotes VCMGP Bind calcium crystals and inhibits apatite growth, bind BMP-2 Inhibit VCFetuin-A Bind calcium phosphate and decrease inflammation, inhibits VSMC apoptosis Inhibits VC Table 1: Soluble biomarkers and regulators of calcificationADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1186/1475-2840-13-85”, “ISBN” : “1475-2840 (Electronic)
1475-2840 (Linking)”, “ISSN” : “1475-2840”, “PMID” : “24762216”, “abstract” : “BACKGROUND: Matrix Gla protein (MGP) is an important inhibitor of calcification. The objective of the present study of patients with type 2 diabetes and normal or slightly altered kidney function was to evaluate levels of inactive, dephospho-uncarboxylated MGP(dp-ucMGP) and total uncarboxylated MGP(t-ucMGP) and assess their links with biological and clinical parameters (including peripheral vascular calcification).
METHODS: The DIACART study is a cross-sectional cohort study of 198 patients with type 2 diabetes and normal or slightly altered kidney function. Matrix Gla protein levels were measured with an ELISA and all patients underwent multislice spiral computed tomography scans to score below-knee arterial calcification.
RESULTS: In the study population as a whole, the mean dp-ucMGP and t-ucMGP levels were 627u2009u00b1u2009451 pM and 4868u2009u00b1u20091613 nM, respectively. Glomerular filtration rate, age and current vitamin K antagonist use were independently associated with dp-ucMGP levels. When the study population was divided according to the median peripheral arterial calcification score, patients with the higher score displayed significantly lower t-ucMGP and significantly higher dp-ucMGP levels. Furthermore, plasma dp-ucMGP was positively associated with the peripheral arterial calcification score (independently of age, gender, previous cardiovascular disease and t-ucMGP levels).
CONCLUSIONS: High dp-ucMGP levels were independently associated with below-knee arterial calcification score in patients with type 2 diabetes and normal or slightly altered kidney function. The reversibility of the elevation of dp-ucMGP levels and the latter’s relationship with clinical events merit further investigation.”, “author” : { “dropping-particle” : “”, “family” : “Liabeuf”, “given” : “Sophie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bourron”, “given” : “Olivier”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Olivier”, “given” : “Bourron”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Vemeer”, “given” : “Cees”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Theuwissen”, “given” : “Elke”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Magdeleyns”, “given” : “Elke”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Aubert”, “given” : “Carole Elodie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Brazier”, “given” : “Michel”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Mentaverri”, “given” : “Romuald”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Hartemann”, “given” : “Agnes”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Massy”, “given” : “Ziad A”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diabetology”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2014” }, “page” : “85”, “title” : “Vascular calcification in patients with type 2 diabetes: the involvement of matrix Gla protein.”, “type” : “article-journal”, “volume” : “13” }, “uris” : “http://www.mendeley.com/documents/?uuid=604d400d-c0a5-4660-bab8-4fffefe07a92” } , “mendeley” : { “formattedCitation” : “31”, “plainTextFormattedCitation” : “31”, “previouslyFormattedCitation” : “31” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }313.Physiology of the AortaArteries are blood vessels that carry blood out of the heart and function in delivering oxygenated blood into organs (except for pulmonary artery). Aorta artery is the largest artery in the body originating from the left ventricle from which all arteries in the body originate, except for the pulmonary artery which arises from the right ventricle. Aorta artery consists of three main parts: the ascending aorta, aortic arch and the descending aorta. Ascending aorta is the part which extends from the left ventricle and from which the coronary arteries branch. The aortic arch is the curved section that connect the ascending and descending parts and from which the subclavian and carotid arteries branch. Descending aorta is the region extending from the arch to the trunk forming thoracic and abdominal aorta.On a narrower scope, the wall of the aorta consists of three distinct layers: the outermost tunica externa (adventitia), tunica media, and the innermost tunica intima. Tunica adventitia is a connective tissue-rich protective layer containing nerve fibers and the vasa vasorum enriching the media with oxygenated blood ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1016/j.cardiores.2007.06.020”, “ISBN” : “0008-6363 (Print)
0008-6363 (Linking)”, “ISSN” : “00086363”, “PMID” : “17631284”, “abstract” : “The function of vasa vasorum is both to deliver nutrients and oxygen to arterial and venous walls and to remove “waste” products, either produced by cells in the wall or introduced by diffusional transport through the endothelium of the artery or vein. Although the relationship between changes in vasa vasorum characteristics and the development of atheromatous plaques is well documented, the role of vasa vasorum, especially in terms of their appearance and disappearance in disease processes such as atherosclerosis, are still not clearly understood in terms of their being causative or merely reactive. However, even if their proliferation is merely reactive, these new microvessels may be a source of disease progression by virtue of endothelial impairment and as a pathway for monocytic cells to migrate to sites of early disease. As both these features are aspects of the vasa vasorum function, this Review focuses on the following issues: 1) acute modulation of vasa vasorum patency due to surrounding compressive forces within vessel wall and due to variable tone in the smooth muscle within proximal vasa vasorum and 2) chronic angiogenic responses due to local cytokine accumulations such as occur in the wall of arteries in the presence of hypertension, hypercholesterolemia, accumulation of lipids, extravasated blood products (e.g., red blood cells, macrophages, inflammatory products) which attract monocytes, and response of vasa vasorum to pharmacological stimuli. ?? 2007 Elsevier B.V. All rights reserved.”, “author” : { “dropping-particle” : “”, “family” : “Ritman”, “given” : “Erik L.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Lerman”, “given” : “Amir”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular Research”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2007” }, “page” : “649-658”, “title” : “The dynamic vasa vasorum”, “type” : “article”, “volume” : “75” }, “uris” : “http://www.mendeley.com/documents/?uuid=1c9e2ac9-2436-47f0-91fb-8ce05cbbdbb5” } , “mendeley” : { “formattedCitation” : “32”, “plainTextFormattedCitation” : “32”, “previouslyFormattedCitation” : “32” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }32 . Tunica media is the main contractile layer consisting of VSMC alternating between elastin, collagen and other constituents of the extracellular matrix (glycoproteins, proteoglycans).ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1159/000108992”, “ISBN” : “0125-9326 (Print) 0125-9326 (Linking)”, “ISSN” : “0125-9326”, “PMID” : “17933075”, “abstract” : “Atherosclerosis is the leading cause of death and disability. The lesions of atherosclerosis represent a series of highly specific cellular and molecular responses. The earliest changes that precede the formation of lesions of atherosclerosis take place in the endothelium (EC), with resultant endothelial dysfunction. The EC-induced injury can result in increased lipid permeability, macrophage recruitment, formation of foam cells, and recruitment of T-lymphocytes and platelet. After intimal injury, different cell types,including ECs, platelets, and inflammatory cells release mediators, such as growth factors and cytokines that induce multiple effects including phenotype change of vascular smooth muscle cells (VSMC) from the quiescent “contractile” phenotype state to the active “synthetic” state, that can migrate and proliferate from media to the intima. The inflammatory response simulates migration and proliferation of VSMC that become intermixed with the area of inflammation to form an intermediate lesion. These responses continue uninhibited and is accompanied by accumulation of new extra cellular matrix (ECM). The migratory and proliferative activities of VSMC are regulated by growth promoters such as platelet derived growth factors (PGF), endothelin-1 (ET-1), thrombin, fibroblast growth factor (FGF), interleukin-1 (IL-1) and inhibitors such as, heparin sulfates , nitric oxide (NO), transforming growth factor (TGF)-beta. The matrix metallo proteinases (MMPs) could also participate in the process of VSMC migration. MMPs could catalyze and remove the basement membrane around VSMC and facilitate contacts with the interstitial matrix. This could promote a change from quiescent, contractile VSMC to cells capable of migrating and proliferating to mediate repair. The VSMC regulation is a very complex process, VSMC are stimulated to proliferate and migrate by some kind of cytokines, growth factors, angiotensin II (Ang-II). Together with apoptosis, proliferation and migration of VSMC are vital to the pathogenesis of atherosclerosis and plaque rupture. Rupture of the plaque is associated with increased fibrous cap macrophage, increased VSMC apoptosis, and reduced fibrous cap VSMC. VSMC are the only cells with plaques capable of synthesizing structurally important collagen isoforms, and the apoptosis of VSMC might promote plaque rupture.”, “author” : { “dropping-particle” : “”, “family” : “Rudijanto”, “given” : “Achmad”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Acta medica Indonesiana”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2007” }, “page” : “86-93”, “title” : “The role of vascular smooth muscle cells on the pathogenesis of atherosclerosis.”, “type” : “article-journal”, “volume” : “39” }, “uris” : “http://www.mendeley.com/documents/?uuid=b3f1202f-1f45-498d-8510-dba594a80785” } , “mendeley” : { “formattedCitation” : “33”, “plainTextFormattedCitation” : “33”, “previouslyFormattedCitation” : “33” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }33 The intimal layer is a monolayer of endothelial cells resting on a basement membrane and separated from the medial layer by membrane called the internal elastic intimaADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1002/dvdy.24247”, “ISBN” : “8585348585”, “ISSN” : “10970177”, “PMID” : “25546231”, “abstract” : “Regional differences in vascular physiology and disease response exist throughout the vascular tree. While these differences in physiology and disease correspond to regional vascular environmental conditions, there is also compelling evidence that the embryonic origins of the smooth muscle inherent to the vessels may play a role. Here, we review what is known regarding the role of embryonic origin of vascular smooth muscle cells during vascular development. The focus of this review is to highlight the heterogeneity in the origins of vascular smooth muscle cells and the resulting regional physiologies of the vessels. Our goal is to stimulate future investigation into this area and provide a better understanding of vascular organogenesis and disease. .”, “author” : { “dropping-particle” : “”, “family” : “Pfaltzgraff”, “given” : “Elise R.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bader”, “given” : “David M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Developmental Dynamics”, “id” : “ITEM-1”, “issue” : “3”, “issued” : { “date-parts” : “2015” }, “page” : “410-416”, “title” : “Heterogeneity in vascular smooth muscle cell embryonic origin in relation to adult structure, physiology, and disease”, “type” : “article”, “volume” : “244” }, “uris” : “http://www.mendeley.com/documents/?uuid=22b21ff8-3dbe-4cc9-a41e-d7da5e7dc426” } , “mendeley” : { “formattedCitation” : “34”, “plainTextFormattedCitation” : “34”, “previouslyFormattedCitation” : “34” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }34.Different regions of the vasculature are distinguished by their unique physical properties needed to perform their specific physiological functions. For instance, there is a difference in the number of smooth muscle layers in the media and the composition of extracellular matrix between the ascending and descending parts. In fact, it is not only a difference in the physiology but also in the susceptibility to diseases. For example, the aortic arch develops atherosclerotic plaques more than other regions and calcifies more rapidly. Authors hypothesize that this may be due to a combination of the embryonic origin and the vascular environment that account for regional variations in physiology and pathologyADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1002/dvdy.24247”, “ISBN” : “8585348585”, “ISSN” : “10970177”, “PMID” : “25546231”, “abstract” : “Regional differences in vascular physiology and disease response exist throughout the vascular tree. While these differences in physiology and disease correspond to regional vascular environmental conditions, there is also compelling evidence that the embryonic origins of the smooth muscle inherent to the vessels may play a role. Here, we review what is known regarding the role of embryonic origin of vascular smooth muscle cells during vascular development. The focus of this review is to highlight the heterogeneity in the origins of vascular smooth muscle cells and the resulting regional physiologies of the vessels. Our goal is to stimulate future investigation into this area and provide a better understanding of vascular organogenesis and disease. .”, “author” : { “dropping-particle” : “”, “family” : “Pfaltzgraff”, “given” : “Elise R.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bader”, “given” : “David M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Developmental Dynamics”, “id” : “ITEM-1”, “issue” : “3”, “issued” : { “date-parts” : “2015” }, “page” : “410-416”, “title” : “Heterogeneity in vascular smooth muscle cell embryonic origin in relation to adult structure, physiology, and disease”, “type” : “article”, “volume” : “244” }, “uris” : “http://www.mendeley.com/documents/?uuid=22b21ff8-3dbe-4cc9-a41e-d7da5e7dc426” } , “mendeley” : { “formattedCitation” : “34”, “plainTextFormattedCitation” : “34”, “previouslyFormattedCitation” : “34” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }343.1Artery calcificationArterial calcification is the ectopic deposition of calcium phosphate crystals in the arterial wall. It occurs particularly in conduit arteries such as aorta, coronary, and carotid arteries and peripheral arteries including digital and pedal arteries. However, each one exhibits different pathophysiology relying on structural and functional differences. Another common site of calcification is the aortic valve and the condition is termed “calcific aortic valvular disease” which has severe complications. Arterial calcification is also possible in small arterioles in the skin leading to localized ischemia.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1159/000108992”, “ISBN” : “0125-9326 (Print) 0125-9326 (Linking)”, “ISSN” : “0125-9326”, “PMID” : “17933075”, “abstract” : “Atherosclerosis is the leading cause of death and disability. The lesions of atherosclerosis represent a series of highly specific cellular and molecular responses. The earliest changes that precede the formation of lesions of atherosclerosis take place in the endothelium (EC), with resultant endothelial dysfunction. The EC-induced injury can result in increased lipid permeability, macrophage recruitment, formation of foam cells, and recruitment of T-lymphocytes and platelet. After intimal injury, different cell types,including ECs, platelets, and inflammatory cells release mediators, such as growth factors and cytokines that induce multiple effects including phenotype change of vascular smooth muscle cells (VSMC) from the quiescent “contractile” phenotype state to the active “synthetic” state, that can migrate and proliferate from media to the intima. The inflammatory response simulates migration and proliferation of VSMC that become intermixed with the area of inflammation to form an intermediate lesion. These responses continue uninhibited and is accompanied by accumulation of new extra cellular matrix (ECM). The migratory and proliferative activities of VSMC are regulated by growth promoters such as platelet derived growth factors (PGF), endothelin-1 (ET-1), thrombin, fibroblast growth factor (FGF), interleukin-1 (IL-1) and inhibitors such as, heparin sulfates , nitric oxide (NO), transforming growth factor (TGF)-beta. The matrix metallo proteinases (MMPs) could also participate in the process of VSMC migration. MMPs could catalyze and remove the basement membrane around VSMC and facilitate contacts with the interstitial matrix. This could promote a change from quiescent, contractile VSMC to cells capable of migrating and proliferating to mediate repair. The VSMC regulation is a very complex process, VSMC are stimulated to proliferate and migrate by some kind of cytokines, growth factors, angiotensin II (Ang-II). Together with apoptosis, proliferation and migration of VSMC are vital to the pathogenesis of atherosclerosis and plaque rupture. Rupture of the plaque is associated with increased fibrous cap macrophage, increased VSMC apoptosis, and reduced fibrous cap VSMC. VSMC are the only cells with plaques capable of synthesizing structurally important collagen isoforms, and the apoptosis of VSMC might promote plaque rupture.”, “author” : { “dropping-particle” : “”, “family” : “Rudijanto”, “given” : “Achmad”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Acta medica Indonesiana”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2007” }, “page” : “86-93”, “title” : “The role of vascular smooth muscle cells on the pathogenesis of atherosclerosis.”, “type” : “article-journal”, “volume” : “39” }, “uris” : “http://www.mendeley.com/documents/?uuid=b3f1202f-1f45-498d-8510-dba594a80785” } , “mendeley” : { “formattedCitation” : “33”, “plainTextFormattedCitation” : “33”, “previouslyFormattedCitation” : “33” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }33. The presence of dystrophic calcification in the arterial wall is considered as a repair mechanism in response to injury and a form of scar tissue ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3265/Nefrologia.pre2011.Oct.11175”, “ISBN” : “1989-2284 (Electronic) 0211-6995 (Linking)”, “ISSN” : “1989-2284”, “PMID” : “22130278”, “abstract” : “Arterial calcification (AC) is a common complication of CKD and ESRD, and the extents of AC are predictive of subsequent cardiovascular mortality beyond established conventional risk factors. AC develop in two distinct sites: the intima and media layers of the large and medium-sized arterial wall. These two forms are frequently associated. AC is tightly associated with aging and arterial remodeling, including intima-media thickening, but also changes of the geometry and function of aortic valves. Evidence has accumulated pointing to the active and regulated nature of the calcification process. Elevated phosphate and calcium may stimulate sodium–dependent phosphate cotransport involving osteoblast–like changes in cellular gene expression. AC is responsible for stiffening of the arteries with increased left ventricular afterload and abnormal coronary perfusion as the principal clinical consequences.”, “author” : { “dropping-particle” : “”, “family” : “London”, “given” : “G M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nefrologu00eda : publicaciu00f3n oficial de la Sociedad Espau00f1ola Nefrologia”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2011” }, “page” : “644-7”, “title” : “Arterial calcification: cardiovascular function and clinical outcome.”, “type” : “article-journal”, “volume” : “31” }, “uris” : “http://www.mendeley.com/documents/?uuid=34ff2654-b7ce-4c77-a54d-f512d293cc9b” } , “mendeley” : { “formattedCitation” : “35”, “plainTextFormattedCitation” : “35”, “previouslyFormattedCitation” : “35” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }35. The process is associated with loss of elasticity, hemodynamic homeostasis, and progressive cardiovascular complicationsADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “ISSN” : “0032-5422”, “PMID” : “28132453”, “abstract” : “Vascular calcification accompanies the pathological process of atherosclerotic plaque formation. Artery calcification results from trans-differentiation of vascular smooth muscle cells (VSMCs) into cells resembling mineralization-competent cells such as osteoblasts and chondrocytes. The activity of tissue-nonspecific alkaline phosphatase (TNAP), a GPI-anchored enzyme necessary for physiological mineralization, is induced in VSMCs in response to inflammation. TNAP achieves its mineralizing function being anchored to plasma membrane of mineralizing cells and to the surface of their derived matrix vesicles (MVs), and numerous important reports indicate that membranes play a crucial role in initiating the crystal formation. In this review, we would like to highlight various functions of lipids and proteins associated to membranes at different stages of both physiological mineralization and vascular calcification, with an emphasis on the pathological process of atherosclerotic plaque formation. Zwapnienie u015bcian naczyu0144 krwionou015bnych towarzyszy procesowi odku0142adania siu0119 blaszki miau017cdu017cycowej. Jest ono wynikiem transdyferencjacji komu00f3rek miu0119u015bni gu0142adkich w kierunku komu00f3rek zdolnych do mineralizacji, o fenotypie zbliu017conym do osteoblastu00f3w i chondrocytu00f3w. Aktywnou015bu0107 tkankowo niespecyficznej alkalicznej fosfatazy (TNAP), enzymu niezbu0119dnego w zapoczu0105tkowaniu procesu fizjologicznej mineralizacji, mou017ce byu0107 ru00f3wnieu017c indukowana w komu00f3rkach miu0119u015bni gu0142adkich naczyu0144 w odpowiedzi na stan zapalny. TNAP zyskuje swu0105 zdolnou015bu0107 do mineralizacji dziu0119ki zakotwiczeniu w bu0142onach komu00f3rek mineralizuju0105cych lub w bu0142onach wydzielonych przez nie pu0119cherzyku00f3w macierzy pozakomu00f3rkowej (MV). Najnowsze doniesienia wskazuju0105 na kluczowu0105 rolu0119 bu0142on w zapoczu0105tkowaniu procesu tworzenia siu0119 minerau0142u. W niniejszym artykule przeglu0105dowym zostau0142y opisane funkcje biau0142ek i lipidu00f3w zwiu0105zanych z bu0142onami komu00f3rkowymi w procesach fizjologicznej oraz patologicznej mineralizacji, ze szczegu00f3lnym uwzglu0119dnieniem procesu00f3w towarzyszu0105cych miau017cdu017cycy.”, “author” : { “dropping-particle” : “”, “family” : “Roszkowska”, “given” : “Monika”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Strzelecka-Kiliszek”, “given” : “Agnieszka”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Magne”, “given” : “David”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Pikula”, “given” : “Slawomir”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bessueille”, “given” : “Laurence”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Postepy biochemii”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2016” }, “page” : “511-517”, “title” : “Membranes and pathophysiological mineralization.”, “type” : “article-journal”, “volume” : “62” }, “uris” : “http://www.mendeley.com/documents/?uuid=ab8236a6-7e28-4736-9409-938f0030af07” } , “mendeley” : { “formattedCitation” : “36”, “plainTextFormattedCitation” : “36”, “previouslyFormattedCitation” : “36” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }36 As mentioned previously,several diseases are predictors of arterial calcification including atherosclerosis, hypertension, diabetes, and renal diseases(discussed later). Two types of arterial calcification exist: intimal and medial calcification(Figure 2). Intima calcification is a hallmark of atherosclerosis characterized by inflammation, macrophage infiltration, lipid deposition and changes in plaque characteristics ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3265/Nefrologia.pre2011.Oct.11175”, “ISBN” : “1989-2284 (Electronic) 0211-6995 (Linking)”, “ISSN” : “1989-2284”, “PMID” : “22130278”, “abstract” : “Arterial calcification (AC) is a common complication of CKD and ESRD, and the extents of AC are predictive of subsequent cardiovascular mortality beyond established conventional risk factors. AC develop in two distinct sites: the intima and media layers of the large and medium-sized arterial wall. These two forms are frequently associated. AC is tightly associated with aging and arterial remodeling, including intima-media thickening, but also changes of the geometry and function of aortic valves. Evidence has accumulated pointing to the active and regulated nature of the calcification process. Elevated phosphate and calcium may stimulate sodium–dependent phosphate cotransport involving osteoblast–like changes in cellular gene expression. AC is responsible for stiffening of the arteries with increased left ventricular afterload and abnormal coronary perfusion as the principal clinical consequences.”, “author” : { “dropping-particle” : “”, “family” : “London”, “given” : “G M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nefrologu00eda : publicaciu00f3n oficial de la Sociedad Espau00f1ola Nefrologia”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2011” }, “page” : “644-7”, “title” : “Arterial calcification: cardiovascular function and clinical outcome.”, “type” : “article-journal”, “volume” : “31” }, “uris” : “http://www.mendeley.com/documents/?uuid=34ff2654-b7ce-4c77-a54d-f512d293cc9b” } , “mendeley” : { “formattedCitation” : “35”, “plainTextFormattedCitation” : “35”, “previouslyFormattedCitation” : “35” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }35. On the other hand, media calcification, also known as M?nckberg sclerosis or media calcinosis is manifested by diffuse mineral deposition in the tunica mediaADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3265/Nefrologia.pre2011.Oct.11175”, “ISBN” : “1989-2284 (Electronic) 0211-6995 (Linking)”, “ISSN” : “1989-2284”, “PMID” : “22130278”, “abstract” : “Arterial calcification (AC) is a common complication of CKD and ESRD, and the extents of AC are predictive of subsequent cardiovascular mortality beyond established conventional risk factors. AC develop in two distinct sites: the intima and media layers of the large and medium-sized arterial wall. These two forms are frequently associated. AC is tightly associated with aging and arterial remodeling, including intima-media thickening, but also changes of the geometry and function of aortic valves. Evidence has accumulated pointing to the active and regulated nature of the calcification process. Elevated phosphate and calcium may stimulate sodium–dependent phosphate cotransport involving osteoblast–like changes in cellular gene expression. AC is responsible for stiffening of the arteries with increased left ventricular afterload and abnormal coronary perfusion as the principal clinical consequences.”, “author” : { “dropping-particle” : “”, “family” : “London”, “given” : “G M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nefrologu00eda : publicaciu00f3n oficial de la Sociedad Espau00f1ola Nefrologia”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2011” }, “page” : “644-7”, “title” : “Arterial calcification: cardiovascular function and clinical outcome.”, “type” : “article-journal”, “volume” : “31” }, “uris” : “http://www.mendeley.com/documents/?uuid=34ff2654-b7ce-4c77-a54d-f512d293cc9b” } , “mendeley” : { “formattedCitation” : “35”, “plainTextFormattedCitation” : “35”, “previouslyFormattedCitation” : “35” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }35. It is frequently observed in individuals with metabolic disorders such as diabetes mellitus and chronic kidney disease. The clinical outcome of this type is arterial stiffness, increased cardiac post-load, and dysregulation of hemodynamicsADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3978/j.issn.2223-3652.2015.06.05”, “ISSN” : “2223-3652”, “PMID” : “26543821”, “abstract” : “Vascular calcification (VC) is the deposition of calcium/phosphate in the vasculature, which portends a worse clinical outcome and predicts major adverse cardiovascular events. VC is an active process initiated and regulated via a variety of molecular signalling pathways. There are mainly two types of calcifications: the media VC and the intima VC. All major risk factors for cardiovascular disease (CVD) have been linked to the presence/development of VC. Besides the risk factors, a genetic component is also operative to determine arterial calcification. Several events take place before VC is established, including inflammation, trans-differentiation of vascular cells and homing of circulating pro-calcific cells. Diabetes is an important predisposing factor for VC. Compared with non-diabetic subjects, patients with diabetes show increased VC and higher expression of bone-related proteins in the medial layer of the vessels. In this review we will highlight the mechanisms underlying vascular calcification in diabetic patients.”, “author” : { “dropping-particle” : “”, “family” : “Avogaro”, “given” : “Angelo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fadini”, “given” : “Gian Paolo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diagnosis and therapy”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2015” }, “page” : “343-52”, “title” : “Mechanisms of ectopic calcification: implications for diabetic vasculopathy.”, “type” : “article-journal”, “volume” : “5” }, “uris” : “http://www.mendeley.com/documents/?uuid=c5a83d55-28fe-4953-bba5-91cd8d1ff141” } , “mendeley” : { “formattedCitation” : “1”, “plainTextFormattedCitation” : “1”, “previouslyFormattedCitation” : “1” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }1.Figure 2: Different types of arterial calcificationADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1038/nrendo.2012.36”, “ISBN” : “1759-5037 (Electronic)
1759-5029 (Linking)”, “ISSN” : “1759-5029”, “PMID” : “22473330”, “abstract” : “Bone never forms without vascular interactions. This simple statement of fact does not adequately reflect the physiological and pharmacological implications of the relationship. The vasculature is the conduit for nutrient exchange between bone and the rest of the body. The vasculature provides the sustentacular niche for development of osteoblast progenitors and is the conduit for egress of bone marrow cell products arising, in turn, from the osteoblast-dependent haematopoietic niche. Importantly, the second most calcified structure in humans after the skeleton is the vasculature. Once considered a passive process of dead and dying cells, vascular calcification has emerged as an actively regulated form of tissue biomineralization. Skeletal morphogens and osteochondrogenic transcription factors are expressed by cells within the vessel wall, which regulates the deposition of vascular calcium. Osteotropic hormones, including parathyroid hormone, regulate both vascular and skeletal mineralization. Cellular, endocrine and metabolic signals that flow bidirectionally between the vasculature and bone are necessary for both bone health and vascular health. Dysmetabolic states including diabetes mellitus, uraemia and hyperlipidaemia perturb the bone-vascular axis, giving rise to devastating vascular and skeletal disease. A detailed understanding of bone-vascular interactions is necessary to address the unmet clinical needs of an increasingly aged and dysmetabolic population.”, “author” : { “dropping-particle” : “”, “family” : “Thompson”, “given” : “Bithika”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Towler”, “given” : “Dwight a.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nature Reviews Endocrinology”, “id” : “ITEM-1”, “issue” : “9”, “issued” : { “date-parts” : “2012” }, “page” : “529-543”, “title” : “Arterial calcification and bone physiology: role of the boneu2013vascular axis”, “type” : “article-journal”, “volume” : “8” }, “uris” : “http://www.mendeley.com/documents/?uuid=5eeba70a-3bea-4833-908a-67c3be6f65f9” } , “mendeley” : { “formattedCitation” : “5”, “plainTextFormattedCitation” : “5”, “previouslyFormattedCitation” : “5” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }54.Passive versus active modelVC has been previously considered as a passive degenerative process of mineral precipitation when Pi x Ca product exceeds a certain limit and due to absence of calcification inhibitors such as MGP. However numerous studies have shown that even if the Ca x Pi product was normal vascular calcification still occurs such as in patients with diabetes mellitusADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1210/er.2003-0015”, “ISBN” : “0163-769X (Print)”, “ISSN” : “0163769X”, “PMID” : “15294885”, “abstract” : “Pathologists have recognized arterial calcification for over a century. Recent years have witnessed a strong resurgence of interest in atherosclerotic plaque calcification because it: 1) can be easily detected noninvasively; 2) closely correlates with the amount of atherosclerotic plaque; 3) serves as a surrogate measure for atherosclerosis, allowing preclinical detection of the disease; and 4) is associated with heightened risk of adverse cardiovascular events. There are two major types of calcification in arteries: calcification of the media tunica layer (sometimes called Mu00f6nckeberg’s sclerosis), and calcification within subdomains of atherosclerotic plaque within the intimal layer of the artery. There are important similarities and differences between these two entities. Of particular interest are increasing parallels between cellular and molecular features of arterial calcification and bone biology, and this has led to accelerating interest in understanding how and why bone-like mineral deposits may form in arteries. Here, we review the two major pathological types of arterial calcification, the proposed models of calcification, and endocrine and genetic determinants that affect arterial calcification. In addition, we highlight areas requiring further investigation.”, “author” : { “dropping-particle” : “”, “family” : “Doherty”, “given” : “Terence M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fitzpatrick”, “given” : “Lorraine A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Inoue”, “given” : “Daisuke”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Qiao”, “given” : “Jian Hua”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fishbein”, “given” : “Michael C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Detrano”, “given” : “Robert C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shah”, “given” : “Prediman K.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rajavashisth”, “given” : “Tripathi B.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Endocrine Reviews”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2004” }, “page” : “629-672”, “title” : “Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification”, “type” : “article”, “volume” : “25” }, “uris” : “http://www.mendeley.com/documents/?uuid=a9b6d01d-e6ad-4aea-8655-072928f7d6b3” } , “mendeley” : { “formattedCitation” : “4”, “plainTextFormattedCitation” : “4”, “previouslyFormattedCitation” : “4” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }4. As such, this view has been abandoned and overwhelming evidences suggest that it is a highly regulated active process that involves the trans-differentiation of vascular smooth muscle cells (VSMC) into an osteo/chondrogenic phenotype and the release of matrix vesiclesADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3389/fgene.2012.00290”, “ISBN” : “1664-8021”, “ISSN” : “16648021”, “PMID” : “23248645”, “abstract” : “Vascular disease is still the leading cause of morbidity and mortality in the Western world, and the primary cause of myocardial infarction, stroke, and ischemia. The biology of vascular disease is complex and still poorly understood in terms of causes and consequences. Vascular function is determined by structural and functional properties of the arterial vascular wall. Arterial stiffness, that is a pathological alteration of the vascular wall, ultimately results in target-organ damage and increased mortality. Arterial remodeling is accelerated under conditions that adversely affect the balance between arterial function and structure such as hypertension, atherosclerosis, diabetes mellitus, chronic kidney disease, inflammatory disease, lifestyle aspects (smoking), drugs (vitamin K antagonists) and genetic abnormalities (e.g. pseudoxanthoma elasticum, Marfanu2019s disease). The aim of this review is to provide an overview of the complex mechanisms and different factors that underlie arterial remodeling, learning from single gene defect diseases like PXE, and PXE-like, Marfanu2019s disease and Keutel syndrome in vascular remodeling.”, “author” : { “dropping-particle” : “”, “family” : “Varik”, “given” : “Bernard J.”, “non-dropping-particle” : “Van”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rennenberg”, “given” : “Roger J M W”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Reutelingsperger”, “given” : “Chris P.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kroon”, “given” : “Abraham A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Leeuw”, “given” : “Peter W.”, “non-dropping-particle” : “De”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Schurgers”, “given” : “Leon J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Genetics”, “id” : “ITEM-1”, “issue” : “DEC”, “issued” : { “date-parts” : “2012” }, “title” : “Mechanisms of arterial remodeling: Lessons from genetic diseases”, “type” : “article”, “volume” : “3” }, “uris” : “http://www.mendeley.com/documents/?uuid=f1b95967-63fe-4058-bc78-758fb7e18f51” } , “mendeley” : { “formattedCitation” : “2”, “plainTextFormattedCitation” : “2”, “previouslyFormattedCitation” : “2” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }2). Although passive precipitation of HA crystals may occur in atherosclerotic plaques as a result of chronic inflammation and necrosisADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1073/pnas.1932554100
1932554100 pii”, “ISBN” : “0027-8424 (Print)
0027-8424 (Linking)”, “ISSN” : “0027-8424”, “PMID” : “14500910”, “abstract” : “Dystrophic or ectopic mineral deposition occurs in many pathologic conditions, including atherosclerosis. Calcium mineral deposits that frequently accompany atherosclerosis are readily quantifiable radiographically, serve as a surrogate marker for the disease, and predict a higher risk of myocardial infarction and death. Accelerating research interest has been propelled by a clear need to understand how plaque structure, composition, and stability lead to devastating cardiovascular events. In atherosclerotic plaque, accumulating evidence is consistent with the notion that calcification involves the participation of arterial osteoblasts and osteoclasts. Here we summarize current models of intimal arterial plaque calcification and highlight intriguing questions that require further investigation. Because atherosclerosis is a chronic vascular inflammation, we propose that arterial plaque calcification is best conceptualized as a convergence of bone biology with vascular inflammatory pathobiology.”, “author” : { “dropping-particle” : “”, “family” : “Doherty”, “given” : “T M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Asotra”, “given” : “K”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fitzpatrick”, “given” : “L A”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Qiao”, “given” : “J H”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Wilkin”, “given” : “D J”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Detrano”, “given” : “R C”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Dunstan”, “given” : “C R”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shah”, “given” : “P K”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rajavashisth”, “given” : “T B”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Proc Natl Acad Sci U S A”, “id” : “ITEM-1”, “issue” : “20”, “issued” : { “date-parts” : “2003” }, “page” : “11201-11206”, “title” : “Calcification in atherosclerosis: bone biology and chronic inflammation at the arterial crossroads”, “type” : “article-journal”, “volume” : “100” }, “uris” : “http://www.mendeley.com/documents/?uuid=87c1b058-e4d1-4652-b587-c18db4b99375” } , “mendeley” : { “formattedCitation” : “37”, “plainTextFormattedCitation” : “37”, “previouslyFormattedCitation” : “37” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }37, experimental evidence have shown that in response to particular stimuli VSMC gain the phenotype of an osteogenic cell. This is further depicted in a study where in vitro culture of VSMC treated with high phosphate concentration resulted in the upregulation of bone specific transcription factors: Runx2, osterix and osteogenic marker TNAP and down regulation of VSMC phenotypic markers: SM22a and a-SMA ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3109/07853890.2012.660498”, “ISBN” : “0785-3890”, “ISSN” : “0785-3890”, “PMID” : “22713153”, “abstract” : “Vascular calcification is an active and regulated process which is integral to cardiovascular disease and intimately linked to hypertension. Dysfunctional vascular smooth muscle cells, microvesicles, and dysregulated mineralization inhibitors play key roles in the calcification process, which occurs in the vessel intima in association with atherosclerosis as well as in the vessel media during ageing. Historically hypertension was considered a risk factor promoting atherosclerosis and associated intimal calcification. However, it is now recognized that not all vascular calcification occurs with atherosclerosis, and calcification of the vessel media is associated with arterial stiffening and is a major cause of isolated systolic hypertension in the elderly. Importantly, vascular calcification, regardless of its anatomical site, is an independent risk factor for cardiovascular mortality. Therefore, understanding the factors and mechanisms driving these processes will provide novel therapeutic targets for its prevention and perhaps ultimately its regression.”, “author” : { “dropping-particle” : “”, “family” : “Kalra”, “given” : “Sundeep S.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shanahan”, “given” : “Catherine M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Annals of Medicine”, “id” : “ITEM-1”, “issue” : “sup1”, “issued” : { “date-parts” : “2012” }, “page” : “S85-S92”, “title” : “Vascular calcification and hypertension: Cause and effect”, “type” : “article-journal”, “volume” : “44” }, “uris” : “http://www.mendeley.com/documents/?uuid=5e8911e2-7315-4c66-af23-030604df9be4” } , “mendeley” : { “formattedCitation” : “38”, “plainTextFormattedCitation” : “38”, “previouslyFormattedCitation” : “38” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }38. Therefore, it is crucial to get insight toward the physiological nature of this cell and its unique features enabling it to adopt various phenotypes to deal with environmental changes.5.VSMC plasticityVSMC are key regulators of vascular tone and the main cellular elements of the vascular mediaADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3389/fgene.2012.00290”, “ISBN” : “1664-8021”, “ISSN” : “16648021”, “PMID” : “23248645”, “abstract” : “Vascular disease is still the leading cause of morbidity and mortality in the Western world, and the primary cause of myocardial infarction, stroke, and ischemia. The biology of vascular disease is complex and still poorly understood in terms of causes and consequences. Vascular function is determined by structural and functional properties of the arterial vascular wall. Arterial stiffness, that is a pathological alteration of the vascular wall, ultimately results in target-organ damage and increased mortality. Arterial remodeling is accelerated under conditions that adversely affect the balance between arterial function and structure such as hypertension, atherosclerosis, diabetes mellitus, chronic kidney disease, inflammatory disease, lifestyle aspects (smoking), drugs (vitamin K antagonists) and genetic abnormalities (e.g. pseudoxanthoma elasticum, Marfanu2019s disease). The aim of this review is to provide an overview of the complex mechanisms and different factors that underlie arterial remodeling, learning from single gene defect diseases like PXE, and PXE-like, Marfanu2019s disease and Keutel syndrome in vascular remodeling.”, “author” : { “dropping-particle” : “”, “family” : “Varik”, “given” : “Bernard J.”, “non-dropping-particle” : “Van”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rennenberg”, “given” : “Roger J M W”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Reutelingsperger”, “given” : “Chris P.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kroon”, “given” : “Abraham A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Leeuw”, “given” : “Peter W.”, “non-dropping-particle” : “De”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Schurgers”, “given” : “Leon J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Genetics”, “id” : “ITEM-1”, “issue” : “DEC”, “issued” : { “date-parts” : “2012” }, “title” : “Mechanisms of arterial remodeling: Lessons from genetic diseases”, “type” : “article”, “volume” : “3” }, “uris” : “http://www.mendeley.com/documents/?uuid=f1b95967-63fe-4058-bc78-758fb7e18f51” } , “mendeley” : { “formattedCitation” : “2”, “plainTextFormattedCitation” : “2”, “previouslyFormattedCitation” : “2” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }2 . To fulfill this function, they need to have a contractile phenotype and are thus characterized by a number of phenotype-specific markers including SM22a and a-SMA reflecting their function as hemodynamic balance maintainers. These cells are characterized by their huge plasticity with the ability to modulate their phenotype based on the environmental cues ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1002/dvdy.24247”, “ISBN” : “8585348585”, “ISSN” : “10970177”, “PMID” : “25546231”, “abstract” : “Regional differences in vascular physiology and disease response exist throughout the vascular tree. While these differences in physiology and disease correspond to regional vascular environmental conditions, there is also compelling evidence that the embryonic origins of the smooth muscle inherent to the vessels may play a role. Here, we review what is known regarding the role of embryonic origin of vascular smooth muscle cells during vascular development. The focus of this review is to highlight the heterogeneity in the origins of vascular smooth muscle cells and the resulting regional physiologies of the vessels. Our goal is to stimulate future investigation into this area and provide a better understanding of vascular organogenesis and disease. .”, “author” : { “dropping-particle” : “”, “family” : “Pfaltzgraff”, “given” : “Elise R.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bader”, “given” : “David M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Developmental Dynamics”, “id” : “ITEM-1”, “issue” : “3”, “issued” : { “date-parts” : “2015” }, “page” : “410-416”, “title” : “Heterogeneity in vascular smooth muscle cell embryonic origin in relation to adult structure, physiology, and disease”, “type” : “article”, “volume” : “244” }, “uris” : “http://www.mendeley.com/documents/?uuid=22b21ff8-3dbe-4cc9-a41e-d7da5e7dc426” } , “mendeley” : { “formattedCitation” : “34”, “plainTextFormattedCitation” : “34”, “previouslyFormattedCitation” : “34” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }34. In response to injury or stress, VSMC switch from a quiescent contractile phenotype into a migratory, secretory or an osteoblast like phenotypeADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1159/000108992”, “ISBN” : “0125-9326 (Print) 0125-9326 (Linking)”, “ISSN” : “0125-9326”, “PMID” : “17933075”, “abstract” : “Atherosclerosis is the leading cause of death and disability. The lesions of atherosclerosis represent a series of highly specific cellular and molecular responses. The earliest changes that precede the formation of lesions of atherosclerosis take place in the endothelium (EC), with resultant endothelial dysfunction. The EC-induced injury can result in increased lipid permeability, macrophage recruitment, formation of foam cells, and recruitment of T-lymphocytes and platelet. After intimal injury, different cell types,including ECs, platelets, and inflammatory cells release mediators, such as growth factors and cytokines that induce multiple effects including phenotype change of vascular smooth muscle cells (VSMC) from the quiescent “contractile” phenotype state to the active “synthetic” state, that can migrate and proliferate from media to the intima. The inflammatory response simulates migration and proliferation of VSMC that become intermixed with the area of inflammation to form an intermediate lesion. These responses continue uninhibited and is accompanied by accumulation of new extra cellular matrix (ECM). The migratory and proliferative activities of VSMC are regulated by growth promoters such as platelet derived growth factors (PGF), endothelin-1 (ET-1), thrombin, fibroblast growth factor (FGF), interleukin-1 (IL-1) and inhibitors such as, heparin sulfates , nitric oxide (NO), transforming growth factor (TGF)-beta. The matrix metallo proteinases (MMPs) could also participate in the process of VSMC migration. MMPs could catalyze and remove the basement membrane around VSMC and facilitate contacts with the interstitial matrix. This could promote a change from quiescent, contractile VSMC to cells capable of migrating and proliferating to mediate repair. The VSMC regulation is a very complex process, VSMC are stimulated to proliferate and migrate by some kind of cytokines, growth factors, angiotensin II (Ang-II). Together with apoptosis, proliferation and migration of VSMC are vital to the pathogenesis of atherosclerosis and plaque rupture. Rupture of the plaque is associated with increased fibrous cap macrophage, increased VSMC apoptosis, and reduced fibrous cap VSMC. VSMC are the only cells with plaques capable of synthesizing structurally important collagen isoforms, and the apoptosis of VSMC might promote plaque rupture.”, “author” : { “dropping-particle” : “”, “family” : “Rudijanto”, “given” : “Achmad”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Acta medica Indonesiana”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2007” }, “page” : “86-93”, “title” : “The role of vascular smooth muscle cells on the pathogenesis of atherosclerosis.”, “type” : “article-journal”, “volume” : “39” }, “uris” : “http://www.mendeley.com/documents/?uuid=b3f1202f-1f45-498d-8510-dba594a80785” } , “mendeley” : { “formattedCitation” : “33”, “plainTextFormattedCitation” : “33”, “previouslyFormattedCitation” : “33” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }33. Synthetic VSMC downregulate the expression of genes that are characteristic of differentiated VSMC meeting their contractile function and enhance the expression of others allowing them to adapt varying conditions. For instance, during atherosclerosis, VSMC detach from the basement membrane and migrate toward the intimal layer due to the enhanced production and release of elastolytic enzymes (matrix metalloproteinases) leading to VSMC hyperplasia and contributing to arterial thickening ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3389/fgene.2012.00290”, “ISBN” : “1664-8021”, “ISSN” : “16648021”, “PMID” : “23248645”, “abstract” : “Vascular disease is still the leading cause of morbidity and mortality in the Western world, and the primary cause of myocardial infarction, stroke, and ischemia. The biology of vascular disease is complex and still poorly understood in terms of causes and consequences. Vascular function is determined by structural and functional properties of the arterial vascular wall. Arterial stiffness, that is a pathological alteration of the vascular wall, ultimately results in target-organ damage and increased mortality. Arterial remodeling is accelerated under conditions that adversely affect the balance between arterial function and structure such as hypertension, atherosclerosis, diabetes mellitus, chronic kidney disease, inflammatory disease, lifestyle aspects (smoking), drugs (vitamin K antagonists) and genetic abnormalities (e.g. pseudoxanthoma elasticum, Marfanu2019s disease). The aim of this review is to provide an overview of the complex mechanisms and different factors that underlie arterial remodeling, learning from single gene defect diseases like PXE, and PXE-like, Marfanu2019s disease and Keutel syndrome in vascular remodeling.”, “author” : { “dropping-particle” : “”, “family” : “Varik”, “given” : “Bernard J.”, “non-dropping-particle” : “Van”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rennenberg”, “given” : “Roger J M W”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Reutelingsperger”, “given” : “Chris P.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kroon”, “given” : “Abraham A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Leeuw”, “given” : “Peter W.”, “non-dropping-particle” : “De”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Schurgers”, “given” : “Leon J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Genetics”, “id” : “ITEM-1”, “issue” : “DEC”, “issued” : { “date-parts” : “2012” }, “title” : “Mechanisms of arterial remodeling: Lessons from genetic diseases”, “type” : “article”, “volume” : “3” }, “uris” : “http://www.mendeley.com/documents/?uuid=f1b95967-63fe-4058-bc78-758fb7e18f51” } , “mendeley” : { “formattedCitation” : “2”, “plainTextFormattedCitation” : “2”, “previouslyFormattedCitation” : “2” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }2.Under specific stimuli such as, increased inflammatory cytokines (Il-6 and TNF-?), oxidative stress and activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase modulating downstream reactive oxygen species (ROS) signaling pathways, calcium?phosphate rich diet and hormonal imbalance (Angiotensin II, parathyroid hormone) VSMC trans-differentiate into osteo/chondrocyte like cells and acquires features characteristic of these cells(Figure 3). In an ex vivo study, high phosphate concentration elicit an increase in the expression of Pit-1 in rat aortas compared to vehicle treated, a Na/Pi cotransporter expressed in the osteoblast and required for the process of mineralization and reduce VSMC a-SMA protein ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.5551/jat.28647”, “ISSN” : “1340-3478”, “PMID” : “26119071”, “abstract” : “AIM: High phosphorus conditions promote vascular calcification (VC) in both chronic kidney disease (CKD) patients and experimental models. However, the composition of medial calcification has not been accurately determined, so the objective of this study was to evaluate the mineral composition of calcification in a tissue culture model, not a cell culture system.
METHODS: Aortic rings obtained from male Sprague-Dawley rats were incubated in serum-supplemented medium for 10 days. The inorganic phosphate (Pi) concentration of the medium was increased to induce VC, which was assessed by histology, imaging, and spectroscopy. The mineral composition of the calcification was analyzed using Fourier transform infrared (FTIR) spectroscopic imaging, scanning electron microscopy (SEM), and energy dispersive X-ray spectroscopy (EDX) mapping.
RESULTS: The calcium content significantly increased only in aortic rings cultured for 10 days in the high-Pi medium (HiP: 3.8 mmol/L). The concentration of the phosphate transporter Pit-1 in the aortic tissue exposed to HiP was higher than that in the control incubated sections. The FTIR images and spectra indicated that PO4(3-) was mostly distributed as hydroxyapatite in the medial calcification of aortic rings cultured in HiP. A small quantity of carbonate was identified. The SEM-EDX overlay map demonstrated that phosphorus and calcium simultaneously accumulated and localized in the area of medial calcification induced by exposure to HiP.
CONCLUSION: This is the first report of accurate determination of the chemical composition of aortic medial calcification. Exposure to high Pi concentration augments aortic calcification via an increase in Pit-1, which mainly contains calcium phosphate.”, “author” : { “dropping-particle” : “”, “family” : “Sonou”, “given” : “Tomohiro”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Ohya”, “given” : “Masaki”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Yashiro”, “given” : “Mitsuru”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Masumoto”, “given” : “Asuka”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nakashima”, “given” : “Yuri”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Ito”, “given” : “Teppei”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Mima”, “given” : “Toru”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Negi”, “given” : “Shigeo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kimura-Suda”, “given” : “Hiromi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shigematsu”, “given” : “Takashi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Atherosclerosis and Thrombosis”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2015” }, “page” : “1197-1206”, “title” : “Mineral composition of phosphate-induced calcification in a rat aortic tissue culture model”, “type” : “article-journal”, “volume” : “22” }, “uris” : “http://www.mendeley.com/documents/?uuid=8c4bb9e5-4a6a-4b86-84a6-6abd17d8f722” } , “mendeley” : { “formattedCitation” : “39”, “plainTextFormattedCitation” : “39”, “previouslyFormattedCitation” : “39” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }39. The release of MV, the nidus for HA crystal nucleation, from VSMC was previously described as a rescue mechanism for preventing VSMC apoptosis and later discovered as a mechanism ensuing vascular calcification ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3109/07853890.2012.660498”, “ISBN” : “0785-3890”, “ISSN” : “0785-3890”, “PMID” : “22713153”, “abstract” : “Vascular calcification is an active and regulated process which is integral to cardiovascular disease and intimately linked to hypertension. Dysfunctional vascular smooth muscle cells, microvesicles, and dysregulated mineralization inhibitors play key roles in the calcification process, which occurs in the vessel intima in association with atherosclerosis as well as in the vessel media during ageing. Historically hypertension was considered a risk factor promoting atherosclerosis and associated intimal calcification. However, it is now recognized that not all vascular calcification occurs with atherosclerosis, and calcification of the vessel media is associated with arterial stiffening and is a major cause of isolated systolic hypertension in the elderly. Importantly, vascular calcification, regardless of its anatomical site, is an independent risk factor for cardiovascular mortality. Therefore, understanding the factors and mechanisms driving these processes will provide novel therapeutic targets for its prevention and perhaps ultimately its regression.”, “author” : { “dropping-particle” : “”, “family” : “Kalra”, “given” : “Sundeep S.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shanahan”, “given” : “Catherine M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Annals of Medicine”, “id” : “ITEM-1”, “issue” : “sup1”, “issued” : { “date-parts” : “2012” }, “page” : “S85-S92”, “title” : “Vascular calcification and hypertension: Cause and effect”, “type” : “article-journal”, “volume” : “44” }, “uris” : “http://www.mendeley.com/documents/?uuid=5e8911e2-7315-4c66-af23-030604df9be4” } , “mendeley” : { “formattedCitation” : “38”, “plainTextFormattedCitation” : “38”, “previouslyFormattedCitation” : “38” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }38.639445119380. Figure 3: Mineralizing VSMC elaborate markers of osteo/chondrocyte like cellADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/CIRCRESAHA.110.234260”, “ISBN” : “1524-4571 (Electronic)
0009-7330 (Linking)”, “ISSN” : “00097330”, “PMID” : “21659653”, “abstract” : “The final step of biomineralization is a chemical precipitation reaction that occurs spontaneously in supersaturated or metastable salt solutions. Genetic programs direct precursor cells into a mineralization-competent state in physiological bone formation (osteogenesis) and in pathological mineralization (ectopic mineralization or calcification). Therefore, all tissues not meant to mineralize must be actively protected against chance precipitation of mineral. Fetuin-A is a liver-derived blood protein that acts as a potent inhibitor of ectopic mineralization. Monomeric fetuin-A protein binds small clusters of calcium and phosphate. This interaction results in the formation of prenucleation cluster-laden fetuin-A monomers, calciprotein monomers, and considerably larger aggregates of protein and mineral calciprotein particles. Both monomeric and aggregate forms of fetuin-A mineral accrue acidic plasma protein including albumin, thus stabilizing supersaturated and metastable mineral ion solutions as colloids. Hence, fetuin-A is a mineral carrier protein and a systemic inhibitor of pathological mineralization complementing local inhibitors that act in a cell-restricted or tissue-restricted fashion. Fetuin-A deficiency is associated with soft tissue calcification in mice and humans.”, “author” : { “dropping-particle” : “”, “family” : “Jahnen-Dechent”, “given” : “Willi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Heiss”, “given” : “Alexander”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Schu00e4fer”, “given” : “Cora”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Ketteler”, “given” : “Markus”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Circulation Research”, “id” : “ITEM-1”, “issue” : “12”, “issued” : { “date-parts” : “2011” }, “page” : “1494-1509”, “title” : “Fetuin-A regulation of calcified matrix metabolism”, “type” : “article-journal”, “volume” : “108” }, “uris” : “http://www.mendeley.com/documents/?uuid=d3d4fc51-0920-423a-b31d-1cdc27aadf23” } , “mendeley” : { “formattedCitation” : “40”, “plainTextFormattedCitation” : “40”, “previouslyFormattedCitation” : “40” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }406.Causes of VC: 6.1.VC and CKDVC is the major cause of cardiovascular diseases associated with individuals with CKD knowing that it contributes to impaired myocardial function, myocardial ischemia and several other complicationsADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/CIRCRESAHA.110.225904”, “ISBN” : “1524-4571 (Electronic)
0009-7330 (Linking)”, “ISSN” : “1524-4571”, “PMID” : “21252152”, “abstract” : “Accelerated atherosclerotic plaque calcification and extensive medial calcifications are common and highly detrimental complications of chronic kidney disease. Valid murine models have been developed to investigate both pathologically distinguishable complications, which allow for better insight into the cellular mechanisms underlying these vascular pathologies and evaluation of compounds that might prevent or retard the onset or progression of vascular calcification. This review describes various experimental models that have been used for the study of arterial intimal and/or medial calcification and discusses the extent to which this experimental research has contributed to our current understanding of vascular calcification, particularly in the setting of chronic renal failure.”, “author” : { “dropping-particle” : “”, “family” : “Neven”, “given” : “Ellen”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “D’Haese”, “given” : “Patrick C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Circulation research”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2011” }, “page” : “249-64”, “title” : “Vascular calcification in chronic renal failure: what have we learned from animal studies?”, “type” : “article-journal”, “volume” : “108” }, “uris” : “http://www.mendeley.com/documents/?uuid=64d3fe24-ab7c-44a1-87b2-d106f83271a6” } , “mendeley” : { “formattedCitation” : “41”, “plainTextFormattedCitation” : “41”, “previouslyFormattedCitation” : “41” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }41. In addition to the disturbed mineral balance in these individuals (discussed later), decreased plasma concentration of several inhibitors of calcification such as Fetuin-A and PPi has been reported. Chronic kidney disease is the condition manifested by the gradual loss of the kidney function. Kidneys perform vital roles including waste excretion, water level balancing, blood pressure regulation, and mineral homeostasis. Mineral homeostasis is maintained by the interplay of three organ systems: kidneys, bone, and intestine. Of interest in this manuscript, phosphate and calcium are regulated by variety of hormones and growth factors including PTH, vitamin D metabolites, FGF-23 ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1016/B978-0-12-416015-6.00013-7”, “ISBN” : “9780124160156”, “abstract” : “Calcium and phosphorus homeostasis are important for establishing and preserving the skeletal mechanical structure and for multiple cellular processes. The primary organs involved in these processes are the skeleton, the intestines, the parathyroid glands, and the kidneys. Calcium and phosphorus regulation requires interactions between multiple hormones and transport systems. This chapter will review the contributions of these organs and the relevant hormones for calcium and phosphorus regulation. As will be seen in Chapter 16, disruptions in these systems contribute to some disorders of skeletal and mineral metabolism.”, “author” : { “dropping-particle” : “”, “family” : “DiMeglio”, “given” : “Linda A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Imel”, “given” : “Erik A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Basic and Applied Bone Biology”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2014” }, “page” : “261-282”, “title” : “Chapter 13 u2013 Calcium and Phosphate: Hormonal Regulation and Metabolism”, “type” : “chapter” }, “uris” : “http://www.mendeley.com/documents/?uuid=de948560-7dd9-4b95-a6df-1d0f76eb65d2” } , “mendeley” : { “formattedCitation” : “42”, “plainTextFormattedCitation” : “42”, “previouslyFormattedCitation” : “42” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }42.High levels of PTH function in bone resorption resulting in decreased osteoblast proliferation and osteoclast activation releasing calcium (Ca) and phosphate (P).At the level of the kidneys, PTH reduce Ca reabsorption but stimulate that of P along with FGF-23. The active form of vitamin D 1, 25(OH) 2D3 stimulates intestinal and phosphate absorption.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1016/B978-0-12-416015-6.00013-7”, “ISBN” : “9780124160156”, “abstract” : “Calcium and phosphorus homeostasis are important for establishing and preserving the skeletal mechanical structure and for multiple cellular processes. The primary organs involved in these processes are the skeleton, the intestines, the parathyroid glands, and the kidneys. Calcium and phosphorus regulation requires interactions between multiple hormones and transport systems. This chapter will review the contributions of these organs and the relevant hormones for calcium and phosphorus regulation. As will be seen in Chapter 16, disruptions in these systems contribute to some disorders of skeletal and mineral metabolism.”, “author” : { “dropping-particle” : “”, “family” : “DiMeglio”, “given” : “Linda A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Imel”, “given” : “Erik A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Basic and Applied Bone Biology”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2014” }, “page” : “261-282”, “title” : “Chapter 13 u2013 Calcium and Phosphate: Hormonal Regulation and Metabolism”, “type” : “chapter” }, “uris” : “http://www.mendeley.com/documents/?uuid=de948560-7dd9-4b95-a6df-1d0f76eb65d2” } , “mendeley” : { “formattedCitation” : “42”, “plainTextFormattedCitation” : “42”, “previouslyFormattedCitation” : “42” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }42One of the complications associated with the progression CKD is hyperphosphatemia caused by reduced renal excretion of phosphate. Elevated blood level of phosphate induces FGF-23 production which functions in inhibiting Cytochrome P27B1 (CYP27B1); the enzyme required for the generation of the active form 1, 25 (OH) 2D3 thus reducing calcium intestinal absorption. High levels of P with low levels of Ca and vitamin D induce PTH hormone production which normally enhances P excretion however in individuals with renal failure; the kidneys are not able to function properly. This will make the situation more complicated and thus PTH now recruit Ca from the bone together with phosphorus leading to increased plasma concentration of Ca and maintaining high blood levels of phosphorus favoring VC ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/CIRCRESAHA.110.225904”, “ISBN” : “1524-4571 (Electronic)
0009-7330 (Linking)”, “ISSN” : “1524-4571”, “PMID” : “21252152”, “abstract” : “Accelerated atherosclerotic plaque calcification and extensive medial calcifications are common and highly detrimental complications of chronic kidney disease. Valid murine models have been developed to investigate both pathologically distinguishable complications, which allow for better insight into the cellular mechanisms underlying these vascular pathologies and evaluation of compounds that might prevent or retard the onset or progression of vascular calcification. This review describes various experimental models that have been used for the study of arterial intimal and/or medial calcification and discusses the extent to which this experimental research has contributed to our current understanding of vascular calcification, particularly in the setting of chronic renal failure.”, “author” : { “dropping-particle” : “”, “family” : “Neven”, “given” : “Ellen”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “D’Haese”, “given” : “Patrick C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Circulation research”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2011” }, “page” : “249-64”, “title” : “Vascular calcification in chronic renal failure: what have we learned from animal studies?”, “type” : “article-journal”, “volume” : “108” }, “uris” : “http://www.mendeley.com/documents/?uuid=64d3fe24-ab7c-44a1-87b2-d106f83271a6” } , “mendeley” : { “formattedCitation” : “41”, “plainTextFormattedCitation” : “41”, “previouslyFormattedCitation” : “41” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }41.The correlation of CKD with ectopic calcification and more precisely medial aortic calcification has been further emphasized by the use of animal models including remnant kidney rats fed with high phosphorus and 1,25(OH)2D3 diet or adenine induced CKD rat model on a low protein diet. These animal models are also used to assess the therapeutic efficacy of various drugs used for the treatment of VC in CKD patients including phosphate binding agents and calcimimticsADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/CIRCRESAHA.110.225904”, “ISBN” : “1524-4571 (Electronic)
0009-7330 (Linking)”, “ISSN” : “1524-4571”, “PMID” : “21252152”, “abstract” : “Accelerated atherosclerotic plaque calcification and extensive medial calcifications are common and highly detrimental complications of chronic kidney disease. Valid murine models have been developed to investigate both pathologically distinguishable complications, which allow for better insight into the cellular mechanisms underlying these vascular pathologies and evaluation of compounds that might prevent or retard the onset or progression of vascular calcification. This review describes various experimental models that have been used for the study of arterial intimal and/or medial calcification and discusses the extent to which this experimental research has contributed to our current understanding of vascular calcification, particularly in the setting of chronic renal failure.”, “author” : { “dropping-particle” : “”, “family” : “Neven”, “given” : “Ellen”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “D’Haese”, “given” : “Patrick C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Circulation research”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2011” }, “page” : “249-64”, “title” : “Vascular calcification in chronic renal failure: what have we learned from animal studies?”, “type” : “article-journal”, “volume” : “108” }, “uris” : “http://www.mendeley.com/documents/?uuid=64d3fe24-ab7c-44a1-87b2-d106f83271a6” } , “mendeley” : { “formattedCitation” : “41”, “plainTextFormattedCitation” : “41”, “previouslyFormattedCitation” : “41” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }41.6.2.VC and DiabetesNumerous studies in the past 20 years have shown a strong tight relation between hyperglycemia, impaired insulin signaling and vascular pathologyADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3978/j.issn.2223-3652.2014.08.02”, “ISBN” : “2223-3652 (Print)
2223-3652 (Linking)”, “ISSN” : “2223-3652”, “PMID” : “25276618”, “abstract” : “Prevalence of obesity and type 2 diabetes (T2DM) is alarmingly increasing worldwide. Albeit advances in therapy have reduced morbidity and mortality in T2DM, cardiovascular risk is far to be eradicated and mechanism-based therapeutic approaches are in high demand. In this perspective, deciphering novel molecular networks of vascular disease will be instrumental to develop novel diagnostic and therapeutic strategies in people affected by diabetes. There is therefore a need to address current knowledge gaps in disease aetiology in order to support innovation in diagnosis and treatment. Unfortunately, we are still lacking cost-effective markers able to identify atherosclerotic vascular disease at an early stage. The issue of risk stratification deserves attention because not every T2DM patient carries the same degree of inflammation and oxidative stress. The diversity of metabolic phenotypes with different outcomes underscores the need for cardiovascular risk stratification within such heterogeneous population. Early predictors of vascular damage are mandatory to implement intensive treatment strategies and, hence, reduce cardiovascular disease burden in this setting. In this review we critically discuss novel molecular mechanisms of diabetic vascular disease and their possible translation to the clinical setting.”, “author” : { “dropping-particle” : “”, “family” : “Paneni”, “given” : “Francesco”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Costantino”, “given” : “Sarah”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Cosentino”, “given” : “Francesco”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diagnosis and therapy”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2014” }, “page” : “324-32”, “title” : “Molecular mechanisms of vascular dysfunction and cardiovascular biomarkers in type 2 diabetes.”, “type” : “article-journal”, “volume” : “4” }, “uris” : “http://www.mendeley.com/documents/?uuid=9abc7ef7-6412-4f47-899c-2733eda7f747” } , “mendeley” : { “formattedCitation” : “43”, “plainTextFormattedCitation” : “43”, “previouslyFormattedCitation” : “43” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }43. Diabetes is a predisposing factor for VC and a strong predictor of cardiovascular disease. Individuals with diabetes show increased expression of bone-related proteins in their vessels such as BMP, collagen type I and TNAP compared to non-diabetic subjects. In diabetic patients, medial VC occurs in coronary arteries and arteries of the lower limbs and act as future predictors of cardiovascular related diabetic complications such as stroke and lower limb amputations. Several mechanisms may be involved in the vulnerability to VCADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3978/j.issn.2223-3652.2015.06.05”, “ISSN” : “2223-3652”, “PMID” : “26543821”, “abstract” : “Vascular calcification (VC) is the deposition of calcium/phosphate in the vasculature, which portends a worse clinical outcome and predicts major adverse cardiovascular events. VC is an active process initiated and regulated via a variety of molecular signalling pathways. There are mainly two types of calcifications: the media VC and the intima VC. All major risk factors for cardiovascular disease (CVD) have been linked to the presence/development of VC. Besides the risk factors, a genetic component is also operative to determine arterial calcification. Several events take place before VC is established, including inflammation, trans-differentiation of vascular cells and homing of circulating pro-calcific cells. Diabetes is an important predisposing factor for VC. Compared with non-diabetic subjects, patients with diabetes show increased VC and higher expression of bone-related proteins in the medial layer of the vessels. In this review we will highlight the mechanisms underlying vascular calcification in diabetic patients.”, “author” : { “dropping-particle” : “”, “family” : “Avogaro”, “given” : “Angelo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fadini”, “given” : “Gian Paolo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diagnosis and therapy”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2015” }, “page” : “343-52”, “title” : “Mechanisms of ectopic calcification: implications for diabetic vasculopathy.”, “type” : “article-journal”, “volume” : “5” }, “uris” : “http://www.mendeley.com/documents/?uuid=c5a83d55-28fe-4953-bba5-91cd8d1ff141” } , “mendeley” : { “formattedCitation” : “1”, “plainTextFormattedCitation” : “1”, “previouslyFormattedCitation” : “1” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }1. High glucose induces ROS release which are upstream regulators of complex molecular networks leading to endothelial dysfunction and contribute hugely to the trasndifferentiation of VSMC into osteogenic phenotype. ROS upregulate the expression of NF-?b and protein kinase C (PKC). PKC-ß2 isoform is highly detected in diabetic patients and function in ROS accumulation in mitochondria and further production by NADPH oxidaseADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3978/j.issn.2223-3652.2014.08.02”, “ISBN” : “2223-3652 (Print)
2223-3652 (Linking)”, “ISSN” : “2223-3652”, “PMID” : “25276618”, “abstract” : “Prevalence of obesity and type 2 diabetes (T2DM) is alarmingly increasing worldwide. Albeit advances in therapy have reduced morbidity and mortality in T2DM, cardiovascular risk is far to be eradicated and mechanism-based therapeutic approaches are in high demand. In this perspective, deciphering novel molecular networks of vascular disease will be instrumental to develop novel diagnostic and therapeutic strategies in people affected by diabetes. There is therefore a need to address current knowledge gaps in disease aetiology in order to support innovation in diagnosis and treatment. Unfortunately, we are still lacking cost-effective markers able to identify atherosclerotic vascular disease at an early stage. The issue of risk stratification deserves attention because not every T2DM patient carries the same degree of inflammation and oxidative stress. The diversity of metabolic phenotypes with different outcomes underscores the need for cardiovascular risk stratification within such heterogeneous population. Early predictors of vascular damage are mandatory to implement intensive treatment strategies and, hence, reduce cardiovascular disease burden in this setting. In this review we critically discuss novel molecular mechanisms of diabetic vascular disease and their possible translation to the clinical setting.”, “author” : { “dropping-particle” : “”, “family” : “Paneni”, “given” : “Francesco”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Costantino”, “given” : “Sarah”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Cosentino”, “given” : “Francesco”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diagnosis and therapy”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2014” }, “page” : “324-32”, “title” : “Molecular mechanisms of vascular dysfunction and cardiovascular biomarkers in type 2 diabetes.”, “type” : “article-journal”, “volume” : “4” }, “uris” : “http://www.mendeley.com/documents/?uuid=9abc7ef7-6412-4f47-899c-2733eda7f747” } , “mendeley” : { “formattedCitation” : “43”, “plainTextFormattedCitation” : “43”, “previouslyFormattedCitation” : “43” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }43.Advanced glycation end products (AGEs) are extensively sugar-modified proteins considered potential biomarkers of cardiovascular complications in diabetic patients. These are associated with oxidative stress and the release of inflammatory cytokines IL-8 and MCP-1 as well as MMP- 9 suggesting their role in arterial remodeling ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3978/j.issn.2223-3652.2014.08.02”, “ISBN” : “2223-3652 (Print)
2223-3652 (Linking)”, “ISSN” : “2223-3652”, “PMID” : “25276618”, “abstract” : “Prevalence of obesity and type 2 diabetes (T2DM) is alarmingly increasing worldwide. Albeit advances in therapy have reduced morbidity and mortality in T2DM, cardiovascular risk is far to be eradicated and mechanism-based therapeutic approaches are in high demand. In this perspective, deciphering novel molecular networks of vascular disease will be instrumental to develop novel diagnostic and therapeutic strategies in people affected by diabetes. There is therefore a need to address current knowledge gaps in disease aetiology in order to support innovation in diagnosis and treatment. Unfortunately, we are still lacking cost-effective markers able to identify atherosclerotic vascular disease at an early stage. The issue of risk stratification deserves attention because not every T2DM patient carries the same degree of inflammation and oxidative stress. The diversity of metabolic phenotypes with different outcomes underscores the need for cardiovascular risk stratification within such heterogeneous population. Early predictors of vascular damage are mandatory to implement intensive treatment strategies and, hence, reduce cardiovascular disease burden in this setting. In this review we critically discuss novel molecular mechanisms of diabetic vascular disease and their possible translation to the clinical setting.”, “author” : { “dropping-particle” : “”, “family” : “Paneni”, “given” : “Francesco”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Costantino”, “given” : “Sarah”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Cosentino”, “given” : “Francesco”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diagnosis and therapy”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2014” }, “page” : “324-32”, “title” : “Molecular mechanisms of vascular dysfunction and cardiovascular biomarkers in type 2 diabetes.”, “type” : “article-journal”, “volume” : “4” }, “uris” : “http://www.mendeley.com/documents/?uuid=9abc7ef7-6412-4f47-899c-2733eda7f747” } , “mendeley” : { “formattedCitation” : “43”, “plainTextFormattedCitation” : “43”, “previouslyFormattedCitation” : “43” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }43. It has been shown that their receptors are co-localized with VSMC undergoing osteo/chondrogenic differentiation in rodents with diet-induced diabetes. A recent study identified a new population of mononuclear cells expressing OCN and TNAP called myeloid calcifying cells (MCCS) producing spotty areas of calcification and are over presented in patients with type II diabetes.Another mechanism may be the inhibition of vitamin k dependent activation of the inhibitor of calcification MGP. A study on 198 patients having type II diabetes with normal or slightly altered kidney function demonstrate a positive association of plasma dephosphorylated uncarboxylated MGP (dp-ucMGP) and peripheral arterial calcification ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1074/jbc.M111.251462”, “ISBN” : “1083-351X (Electronic)
0021-9258 (Linking)”, “ISSN” : “1083-351X”, “PMID” : “21705322”, “abstract” : “Matrix Gla protein (MGP) is an inhibitor of vascular calcification but its mechanism of action and pathogenic role are unclear. This was examined in cultured rat aortas and in a model of vascular calcification in rats with renal failure. Both carboxylated (GlaMGP) and uncarboxylated (GluMGP) forms were present in aorta and disappeared during culture with warfarin. MGP was also released into the medium and removed by ultracentrifugation, and similarly affected by warfarin. In a high-phosphate medium, warfarin increased aortic calcification but only in the absence of pyrophosphate, another endogenous inhibitor of vascular calcification. Although GlaMGP binds and inactivates bone morphogenic protein (BMP)-2, a proposed mediator of vascular calcification through up-regulation of the osteogenic transcription factor runx2, neither warfarin, BMP-2, nor the BMP-2 antagonist noggin altered runx2 mRNA content in aortas, and noggin did not prevent warfarin-induced calcification. Aortic content of MGP mRNA was increased 5-fold in renal failure but did not differ between calcified and noncalcified aortas. Immunoblots showed increased GlaMGP in noncalcified (5-fold) and calcified (20-fold) aortas from rats with renal failure, with similar increases in GluMGP. We conclude that rat aortic smooth muscle produces both GlaMGP and GluMGP in tissue-bound and soluble, presumably vesicular, forms. MGP inhibits calcification independent of BMP-2-driven osteogenesis and only in the absence of pyrophosphate, consistent with direct inhibition of hydroxyapatite formation. Synthesis of MGP is increased in renal failure and deficiency of GlaMGP is not a primary cause of medial calcification in this condition.”, “author” : { “dropping-particle” : “”, “family” : “Lomashvili”, “given” : “Koba a”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Wang”, “given” : “Xiaonan”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Wallin”, “given” : “Reidar”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “O’Neill”, “given” : “W Charles”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “The Journal of biological chemistry”, “id” : “ITEM-1”, “issue” : “33”, “issued” : { “date-parts” : “2011” }, “page” : “28715-22”, “title” : “Matrix Gla protein metabolism in vascular smooth muscle and role in uremic vascular calcification.”, “type” : “article-journal”, “volume” : “286” }, “uris” : “http://www.mendeley.com/documents/?uuid=365efb30-d3ab-4381-a6bd-e38fd6047b1a” } , “mendeley” : { “formattedCitation” : “44”, “plainTextFormattedCitation” : “44”, “previouslyFormattedCitation” : “44” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }44.Diabetic mice and rats show an increase in aortic BMP activity that was associated with increased calcium accumulation. Similar results were observed in human aortic endothelial cells receiving high glucose concentration suggesting a role for vascular cells in osteogenic activation ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3978/j.issn.2223-3652.2015.06.05”, “ISSN” : “2223-3652”, “PMID” : “26543821”, “abstract” : “Vascular calcification (VC) is the deposition of calcium/phosphate in the vasculature, which portends a worse clinical outcome and predicts major adverse cardiovascular events. VC is an active process initiated and regulated via a variety of molecular signalling pathways. There are mainly two types of calcifications: the media VC and the intima VC. All major risk factors for cardiovascular disease (CVD) have been linked to the presence/development of VC. Besides the risk factors, a genetic component is also operative to determine arterial calcification. Several events take place before VC is established, including inflammation, trans-differentiation of vascular cells and homing of circulating pro-calcific cells. Diabetes is an important predisposing factor for VC. Compared with non-diabetic subjects, patients with diabetes show increased VC and higher expression of bone-related proteins in the medial layer of the vessels. In this review we will highlight the mechanisms underlying vascular calcification in diabetic patients.”, “author” : { “dropping-particle” : “”, “family” : “Avogaro”, “given” : “Angelo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fadini”, “given” : “Gian Paolo”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular diagnosis and therapy”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2015” }, “page” : “343-52”, “title” : “Mechanisms of ectopic calcification: implications for diabetic vasculopathy.”, “type” : “article-journal”, “volume” : “5” }, “uris” : “http://www.mendeley.com/documents/?uuid=c5a83d55-28fe-4953-bba5-91cd8d1ff141” } , “mendeley” : { “formattedCitation” : “1”, “plainTextFormattedCitation” : “1”, “previouslyFormattedCitation” : “1” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }1.Diabetes and its associated complications represent a suitable milieu for the development of VC and despite the great progress in preventive strategies and pharmacotherapy; cardiovascular diseases remain the major cause of mortality in patients with T2DM. Recently, scientists are focusing on epigenetic mechanisms including DNA methylation and miRNA profiles that are disturbed and linked to cardiovascular phenotype.6.3.VC and AtherosclerosisAtherosclerosis is an inflammatory disease characterized by theaccumulation of lipids, infiltration of inflammatory and immune cells, and the deformity of thearterial wall. Atherosclerotic lesions or atheroma are asymmetric focal thickening of the arterial innermost layer, the intima, which develop in response to endothelial injury. Calcification is a prominent feature of atherosclerotic lesions especially in advanced stagesADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “ISSN” : “0032-5422”, “PMID” : “28132453”, “abstract” : “Vascular calcification accompanies the pathological process of atherosclerotic plaque formation. Artery calcification results from trans-differentiation of vascular smooth muscle cells (VSMCs) into cells resembling mineralization-competent cells such as osteoblasts and chondrocytes. The activity of tissue-nonspecific alkaline phosphatase (TNAP), a GPI-anchored enzyme necessary for physiological mineralization, is induced in VSMCs in response to inflammation. TNAP achieves its mineralizing function being anchored to plasma membrane of mineralizing cells and to the surface of their derived matrix vesicles (MVs), and numerous important reports indicate that membranes play a crucial role in initiating the crystal formation. In this review, we would like to highlight various functions of lipids and proteins associated to membranes at different stages of both physiological mineralization and vascular calcification, with an emphasis on the pathological process of atherosclerotic plaque formation. Zwapnienie u015bcian naczyu0144 krwionou015bnych towarzyszy procesowi odku0142adania siu0119 blaszki miau017cdu017cycowej. Jest ono wynikiem transdyferencjacji komu00f3rek miu0119u015bni gu0142adkich w kierunku komu00f3rek zdolnych do mineralizacji, o fenotypie zbliu017conym do osteoblastu00f3w i chondrocytu00f3w. Aktywnou015bu0107 tkankowo niespecyficznej alkalicznej fosfatazy (TNAP), enzymu niezbu0119dnego w zapoczu0105tkowaniu procesu fizjologicznej mineralizacji, mou017ce byu0107 ru00f3wnieu017c indukowana w komu00f3rkach miu0119u015bni gu0142adkich naczyu0144 w odpowiedzi na stan zapalny. TNAP zyskuje swu0105 zdolnou015bu0107 do mineralizacji dziu0119ki zakotwiczeniu w bu0142onach komu00f3rek mineralizuju0105cych lub w bu0142onach wydzielonych przez nie pu0119cherzyku00f3w macierzy pozakomu00f3rkowej (MV). Najnowsze doniesienia wskazuju0105 na kluczowu0105 rolu0119 bu0142on w zapoczu0105tkowaniu procesu tworzenia siu0119 minerau0142u. W niniejszym artykule przeglu0105dowym zostau0142y opisane funkcje biau0142ek i lipidu00f3w zwiu0105zanych z bu0142onami komu00f3rkowymi w procesach fizjologicznej oraz patologicznej mineralizacji, ze szczegu00f3lnym uwzglu0119dnieniem procesu00f3w towarzyszu0105cych miau017cdu017cycy.”, “author” : { “dropping-particle” : “”, “family” : “Roszkowska”, “given” : “Monika”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Strzelecka-Kiliszek”, “given” : “Agnieszka”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Magne”, “given” : “David”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Pikula”, “given” : “Slawomir”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bessueille”, “given” : “Laurence”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Postepy biochemii”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2016” }, “page” : “511-517”, “title” : “Membranes and pathophysiological mineralization.”, “type” : “article-journal”, “volume” : “62” }, “uris” : “http://www.mendeley.com/documents/?uuid=ab8236a6-7e28-4736-9409-938f0030af07” } , “mendeley” : { “formattedCitation” : “36”, “plainTextFormattedCitation” : “36”, “previouslyFormattedCitation” : “36” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }36. It has been estimated that 70% of atherosclerotic lesions are calcified. In apolipoprotein-E deficient (Apo E-/-) mouse model of atherosclerosis, and in the absence of VSMC specific Runx-2, plaque calcification was inhibited. Inflammation and oxidative stress induced during atherosclerosis play a major role in plaque calcification. ROS oxidize LDL to be internalized by macrophages forming lipid laid macrophages or foam cells amplifying the inflammatory response. The process is associated with various cellular and molecular responses by which recruited macrophages and other leukocytes release growth factors, cytokines and other mediators. These induce multiple effects including VSMC differentiation from contractile phenotype into synthetic proliferative phenotype, VSMC migration and proliferation, and extracellular matrix depositionADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1159/000108992”, “ISBN” : “0125-9326 (Print) 0125-9326 (Linking)”, “ISSN” : “0125-9326”, “PMID” : “17933075”, “abstract” : “Atherosclerosis is the leading cause of death and disability. The lesions of atherosclerosis represent a series of highly specific cellular and molecular responses. The earliest changes that precede the formation of lesions of atherosclerosis take place in the endothelium (EC), with resultant endothelial dysfunction. The EC-induced injury can result in increased lipid permeability, macrophage recruitment, formation of foam cells, and recruitment of T-lymphocytes and platelet. After intimal injury, different cell types,including ECs, platelets, and inflammatory cells release mediators, such as growth factors and cytokines that induce multiple effects including phenotype change of vascular smooth muscle cells (VSMC) from the quiescent “contractile” phenotype state to the active “synthetic” state, that can migrate and proliferate from media to the intima. The inflammatory response simulates migration and proliferation of VSMC that become intermixed with the area of inflammation to form an intermediate lesion. These responses continue uninhibited and is accompanied by accumulation of new extra cellular matrix (ECM). The migratory and proliferative activities of VSMC are regulated by growth promoters such as platelet derived growth factors (PGF), endothelin-1 (ET-1), thrombin, fibroblast growth factor (FGF), interleukin-1 (IL-1) and inhibitors such as, heparin sulfates , nitric oxide (NO), transforming growth factor (TGF)-beta. The matrix metallo proteinases (MMPs) could also participate in the process of VSMC migration. MMPs could catalyze and remove the basement membrane around VSMC and facilitate contacts with the interstitial matrix. This could promote a change from quiescent, contractile VSMC to cells capable of migrating and proliferating to mediate repair. The VSMC regulation is a very complex process, VSMC are stimulated to proliferate and migrate by some kind of cytokines, growth factors, angiotensin II (Ang-II). Together with apoptosis, proliferation and migration of VSMC are vital to the pathogenesis of atherosclerosis and plaque rupture. Rupture of the plaque is associated with increased fibrous cap macrophage, increased VSMC apoptosis, and reduced fibrous cap VSMC. VSMC are the only cells with plaques capable of synthesizing structurally important collagen isoforms, and the apoptosis of VSMC might promote plaque rupture.”, “author” : { “dropping-particle” : “”, “family” : “Rudijanto”, “given” : “Achmad”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Acta medica Indonesiana”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2007” }, “page” : “86-93”, “title” : “The role of vascular smooth muscle cells on the pathogenesis of atherosclerosis.”, “type” : “article-journal”, “volume” : “39” }, “uris” : “http://www.mendeley.com/documents/?uuid=b3f1202f-1f45-498d-8510-dba594a80785” } , “mendeley” : { “formattedCitation” : “33”, “plainTextFormattedCitation” : “33”, “previouslyFormattedCitation” : “33” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }33. Various mechanisms underlie the vulnerability of atheroma for calcification. Studies demonstrate that cholesterol and lipid rich deposit accumulation as well as vesicles derived from dead cells act as nucleation sites for hydroxyapatite deposition. Macrophages and mast cells localized within atherosclerotic plaque in different developmental stages release tryptase which is a proteinase implicated in tissue remodeling, fibroblast and epithelial cells proliferation and collagen synthesisADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1002/(sici)1096-9896(199805)185:1;10::aid-path71;3.0.co;2-0”, “ISBN” : “1096-9896”, “ISSN” : “0022-3417”, “PMID” : “9713354”, “abstract” : “Abstract 10.1002/(SICI)1096-9896(199805)185:1;10::AID-PATH71;3.3.CO;2-S Calcification has been examined in 250 samples of atherosclerotic lesions (types II to VI) of human carotid arteries using von Kossa and haematoxylin staining. Early calcification described as u2018stipplingu2019 was first noted in stage III specimens, with intermediate and solid calcifications becoming increasingly prominent within advanced plaques, especially stages Vb and VI. Although the relative frequencies of stippling, intermediate and large calcified deposits varied between plaques of the same stage, the prevalent sites of calcification were recognized as the deeper regions of the intima and the atheroma. Immunolocalization and histochemical techniques were used to identify the associations of mast cells (MCs), macrophages, smooth muscle cells (SMCs), and elastin with the different stages of calcification. Early, dispersed stippling was commonly associated with local accumulations of macrophages (HAM56 and CD68-positive), MCs and extracellular MC tryptase, the presence of immunoreactive elastin, but the relative absence of SMCs. Intermediate stages of calcification described as u2018morulau2019 deposits were also associated with local increases in the numbers of macrophages and MCs. Larger calcified deposits, even within the same plaque specimen, showed no regular pattern of cellular or elastin associations. However, in the vast majority of specimens, macrophages represented the predominant cell type associated with different phases of calcification. By contrast, the calcification less frequently observed in the media beneath advanced plaques was commonly associated with SMCs and elastin; only rarely were macrophages or MCs present. These studies are the first to demonstrate that macrophages, MCs, and extracellular tryptase frequently occupy micro-environmental loci showing the first stages of calcification within the atherosclerotic plaque; similar associations with more advanced mineral deposits are discussed in relation to plaque rupture. u00a9 1998 John Wiley ; Sons, Ltd.”, “author” : { “dropping-particle” : “”, “family” : “Jeziorska”, “given” : “M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “McCollum”, “given” : “C”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Woolley”, “given” : “D E”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “The Journal of Pathology”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “1998” }, “page” : “10-17”, “title” : “Calcification in atherosclerotic plaque of human carotid arteries: associations with mast cells and macrophages”, “type” : “article-journal”, “volume” : “185” }, “uris” : “http://www.mendeley.com/documents/?uuid=b93b3a96-5d73-47e5-b61c-2d5e5652c909” } , “mendeley” : { “formattedCitation” : “45”, “plainTextFormattedCitation” : “45”, “previouslyFormattedCitation” : “45” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }45. Moreover, cholesterol induce the expression of TNAP and stimulate mineralization possibly through ER stress or modulating membrane dynamics leading to MV release. Fatty acids (FAs) appear to play an important role in atherosclerotic plaque calcification. Saturated FAs particularly palmitate and stearate, are known to stimulate VSMC trans-differentiation through endoplasmic reticulum(ER) stress upon phosphatidic acid generation. However unsaturated FAs appear to inhibit calcification and thus omega 3 FAs are efficient for atherosclerosis treatment, since in addition to their role in reducing inflammation they are effective in inhibiting calcification via activating peroxisome proliferator-activated receptor-? (PPAR-?) ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “ISSN” : “0032-5422”, “PMID” : “28132453”, “abstract” : “Vascular calcification accompanies the pathological process of atherosclerotic plaque formation. Artery calcification results from trans-differentiation of vascular smooth muscle cells (VSMCs) into cells resembling mineralization-competent cells such as osteoblasts and chondrocytes. The activity of tissue-nonspecific alkaline phosphatase (TNAP), a GPI-anchored enzyme necessary for physiological mineralization, is induced in VSMCs in response to inflammation. TNAP achieves its mineralizing function being anchored to plasma membrane of mineralizing cells and to the surface of their derived matrix vesicles (MVs), and numerous important reports indicate that membranes play a crucial role in initiating the crystal formation. In this review, we would like to highlight various functions of lipids and proteins associated to membranes at different stages of both physiological mineralization and vascular calcification, with an emphasis on the pathological process of atherosclerotic plaque formation. Zwapnienie u015bcian naczyu0144 krwionou015bnych towarzyszy procesowi odku0142adania siu0119 blaszki miau017cdu017cycowej. Jest ono wynikiem transdyferencjacji komu00f3rek miu0119u015bni gu0142adkich w kierunku komu00f3rek zdolnych do mineralizacji, o fenotypie zbliu017conym do osteoblastu00f3w i chondrocytu00f3w. Aktywnou015bu0107 tkankowo niespecyficznej alkalicznej fosfatazy (TNAP), enzymu niezbu0119dnego w zapoczu0105tkowaniu procesu fizjologicznej mineralizacji, mou017ce byu0107 ru00f3wnieu017c indukowana w komu00f3rkach miu0119u015bni gu0142adkich naczyu0144 w odpowiedzi na stan zapalny. TNAP zyskuje swu0105 zdolnou015bu0107 do mineralizacji dziu0119ki zakotwiczeniu w bu0142onach komu00f3rek mineralizuju0105cych lub w bu0142onach wydzielonych przez nie pu0119cherzyku00f3w macierzy pozakomu00f3rkowej (MV). Najnowsze doniesienia wskazuju0105 na kluczowu0105 rolu0119 bu0142on w zapoczu0105tkowaniu procesu tworzenia siu0119 minerau0142u. W niniejszym artykule przeglu0105dowym zostau0142y opisane funkcje biau0142ek i lipidu00f3w zwiu0105zanych z bu0142onami komu00f3rkowymi w procesach fizjologicznej oraz patologicznej mineralizacji, ze szczegu00f3lnym uwzglu0119dnieniem procesu00f3w towarzyszu0105cych miau017cdu017cycy.”, “author” : { “dropping-particle” : “”, “family” : “Roszkowska”, “given” : “Monika”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Strzelecka-Kiliszek”, “given” : “Agnieszka”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Magne”, “given” : “David”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Pikula”, “given” : “Slawomir”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Bessueille”, “given” : “Laurence”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Postepy biochemii”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2016” }, “page” : “511-517”, “title” : “Membranes and pathophysiological mineralization.”, “type” : “article-journal”, “volume” : “62” }, “uris” : “http://www.mendeley.com/documents/?uuid=ab8236a6-7e28-4736-9409-938f0030af07” } , “mendeley” : { “formattedCitation” : “36”, “plainTextFormattedCitation” : “36”, “previouslyFormattedCitation” : “36” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }36.6.4.VC and HypertensionBlood pressure is the force of blood pushing the walls of the arteries as it flows through them. Hypertension is a long-term medical condition of persistently elevated blood pressure. It is a strong predictor of cardiovascular disease and intimately linked to vascular calcifications, vasoactive agents have been described as modulators of VCADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3109/07853890.2012.660498”, “ISBN” : “0785-3890”, “ISSN” : “0785-3890”, “PMID” : “22713153”, “abstract” : “Vascular calcification is an active and regulated process which is integral to cardiovascular disease and intimately linked to hypertension. Dysfunctional vascular smooth muscle cells, microvesicles, and dysregulated mineralization inhibitors play key roles in the calcification process, which occurs in the vessel intima in association with atherosclerosis as well as in the vessel media during ageing. Historically hypertension was considered a risk factor promoting atherosclerosis and associated intimal calcification. However, it is now recognized that not all vascular calcification occurs with atherosclerosis, and calcification of the vessel media is associated with arterial stiffening and is a major cause of isolated systolic hypertension in the elderly. Importantly, vascular calcification, regardless of its anatomical site, is an independent risk factor for cardiovascular mortality. Therefore, understanding the factors and mechanisms driving these processes will provide novel therapeutic targets for its prevention and perhaps ultimately its regression.”, “author” : { “dropping-particle” : “”, “family” : “Kalra”, “given” : “Sundeep S.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shanahan”, “given” : “Catherine M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Annals of Medicine”, “id” : “ITEM-1”, “issue” : “sup1”, “issued” : { “date-parts” : “2012” }, “page” : “S85-S92”, “title” : “Vascular calcification and hypertension: Cause and effect”, “type” : “article-journal”, “volume” : “44” }, “uris” : “http://www.mendeley.com/documents/?uuid=5e8911e2-7315-4c66-af23-030604df9be4” }, { “id” : “ITEM-2”, “itemData” : { “DOI” : “10.1093/cvr/cvq391”, “ISBN” : “1755-3245 (Electronic)
0008-6363 (Linking)”, “ISSN” : “00086363”, “PMID” : “21156821”, “abstract” : “AIMS: Arterial calcification is a common complication of several disorders and is a strong predictor of mortality. The mechanism underlying arterial calcification is not fully understood and as such, no pharmaceutical therapies are currently available which impede its progression. The aim of this study was to investigate the effects of an angiotensin II (AngII) type 1 receptor blocker (ARB) on arterial calcification.
METHODS AND RESULTS: Male New Zealand White rabbits were fed an atherogenic diet to induce atherosclerosis and arterial calcification over a period of 12 weeks, with an ARB administered in the final 4 weeks. Using clinically relevant micro-computed tomography, we found that animals fed the atherogenic diet displayed extensive arterial calcification when compared with control. In contrast, administration of the ARB completely inhibited calcification (2.80 u00b1 1.17 vs. 0.01 u00b1 0.01% calcified tissue in cholesterol and ARB-treated, respectively; n = 6 and 5; P ; 0.05). Calcified regions were characterized by up-regulation of bone morphogenetic protein 2, osteocalcin, and the AngII type 1 receptor and concomitant down-regulation of u03b1-smooth muscle actin, consistent with a phenotypic switch from vascular to osteoblast-like cells.
CONCLUSION: These data provide the first evidence that angiotensin receptor blockade can inhibit arterial calcification by disrupting vascular osteogenesis and suggest that ARBs may be a novel treatment option for patients suffering from vascular calcification.”, “author” : { “dropping-particle” : “”, “family” : “Armstrong”, “given” : “Zachary B.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Boughner”, “given” : “Derek R.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Drangova”, “given” : “Maria”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rogers”, “given” : “Kem A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular Research”, “id” : “ITEM-2”, “issue” : “1”, “issued” : { “date-parts” : “2011” }, “page” : “165-170”, “title” : “Angiotensin II type 1 receptor blocker inhibits arterial calcification in a pre-clinical model”, “type” : “article-journal”, “volume” : “90” }, “uris” : “http://www.mendeley.com/documents/?uuid=d9056f87-238d-405a-8449-06eb9f53a316” } , “mendeley” : { “formattedCitation” : “38, 46”, “plainTextFormattedCitation” : “38, 46”, “previouslyFormattedCitation” : “38, 46” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }38, 46. Hypertension acts as a cause or effect in different types of calcification. Historically, it was considered as a major risk factor for atherosclerosis and has been linked to intimal calcification. However, medial calcification and hypertension potentiate each other. As elaborated in previous sections, medial calcification decreases the elasticity of the media which results in arterial stiffness that accelerate the pulse wave velocity leading to hypertensionADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3109/07853890.2012.660498”, “ISBN” : “0785-3890”, “ISSN” : “0785-3890”, “PMID” : “22713153”, “abstract” : “Vascular calcification is an active and regulated process which is integral to cardiovascular disease and intimately linked to hypertension. Dysfunctional vascular smooth muscle cells, microvesicles, and dysregulated mineralization inhibitors play key roles in the calcification process, which occurs in the vessel intima in association with atherosclerosis as well as in the vessel media during ageing. Historically hypertension was considered a risk factor promoting atherosclerosis and associated intimal calcification. However, it is now recognized that not all vascular calcification occurs with atherosclerosis, and calcification of the vessel media is associated with arterial stiffening and is a major cause of isolated systolic hypertension in the elderly. Importantly, vascular calcification, regardless of its anatomical site, is an independent risk factor for cardiovascular mortality. Therefore, understanding the factors and mechanisms driving these processes will provide novel therapeutic targets for its prevention and perhaps ultimately its regression.”, “author” : { “dropping-particle” : “”, “family” : “Kalra”, “given” : “Sundeep S.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shanahan”, “given” : “Catherine M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Annals of Medicine”, “id” : “ITEM-1”, “issue” : “sup1”, “issued” : { “date-parts” : “2012” }, “page” : “S85-S92”, “title” : “Vascular calcification and hypertension: Cause and effect”, “type” : “article-journal”, “volume” : “44” }, “uris” : “http://www.mendeley.com/documents/?uuid=5e8911e2-7315-4c66-af23-030604df9be4” } , “mendeley” : { “formattedCitation” : “38”, “plainTextFormattedCitation” : “38”, “previouslyFormattedCitation” : “38” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }38.Hypertension is responsible for structural and functional vascular alterations that are influenced by many humoral factors of which Ang II seems to be criticalADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-003-0073-2”, “ISBN” : “1522-6417 (Print)”, “ISSN” : “1522-6417”, “PMID” : “12642016”, “abstract” : “A major hemodynamic abnormality in hypertension is increased peripheral resistance due to changes in vascular structure and function. Structural changes include reduced lumen diameter and arterial wall thickening. Functional changes include increased vasoconstriction and/or decreased vasodilation. These processes are influenced by many humoral factors, of which angiotensin II (Ang II) seems to be critical. At the cellular level, Ang II stimulates vascular smooth muscle cell growth, increases collagen deposition, induces inflammation, increases contractility, and decreases dilation. Molecular mechanisms associated with these changes in hypertension include upregulation of many signaling pathways, including tyrosine kinases, mitogen-activated protein kinases, RhoA/Rho kinase, and increased generation of reactive oxygen species. This review focuses on the role of Ang II in vascular functional and structural changes of small arteries in hypertension. In addition, cellular processes whereby Ang II influences vessels in hypertension are discussed. Finally, novel concepts related to signaling pathways by which Ang II regulates vascular smooth muscle cells in hypertension are introduced.”, “author” : { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current hypertension reports”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2003” }, “page” : “155-164”, “title” : “The role of angiotensin II in regulating vascular structural and functional changes in hypertension.”, “type” : “article-journal”, “volume” : “5” }, “uris” : “http://www.mendeley.com/documents/?uuid=0d9e5218-7de0-401a-a019-e09e1c700cc8” } , “mendeley” : { “formattedCitation” : “47”, “plainTextFormattedCitation” : “47”, “previouslyFormattedCitation” : “47” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }47. Ang II regulates the vasomotor tone through its potent vasoconstrictor property, it also affects VSMC proliferation and migration and influence cell growth and apoptosis. Studies on animal models of medial calcification have demonstrated that anti-hypertensive treatment such as Ang II blockers have the ability to slow or prevent medial calcificationADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3109/07853890.2012.660498”, “ISBN” : “0785-3890”, “ISSN” : “0785-3890”, “PMID” : “22713153”, “abstract” : “Vascular calcification is an active and regulated process which is integral to cardiovascular disease and intimately linked to hypertension. Dysfunctional vascular smooth muscle cells, microvesicles, and dysregulated mineralization inhibitors play key roles in the calcification process, which occurs in the vessel intima in association with atherosclerosis as well as in the vessel media during ageing. Historically hypertension was considered a risk factor promoting atherosclerosis and associated intimal calcification. However, it is now recognized that not all vascular calcification occurs with atherosclerosis, and calcification of the vessel media is associated with arterial stiffening and is a major cause of isolated systolic hypertension in the elderly. Importantly, vascular calcification, regardless of its anatomical site, is an independent risk factor for cardiovascular mortality. Therefore, understanding the factors and mechanisms driving these processes will provide novel therapeutic targets for its prevention and perhaps ultimately its regression.”, “author” : { “dropping-particle” : “”, “family” : “Kalra”, “given” : “Sundeep S.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shanahan”, “given” : “Catherine M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Annals of Medicine”, “id” : “ITEM-1”, “issue” : “sup1”, “issued” : { “date-parts” : “2012” }, “page” : “S85-S92”, “title” : “Vascular calcification and hypertension: Cause and effect”, “type” : “article-journal”, “volume” : “44” }, “uris” : “http://www.mendeley.com/documents/?uuid=5e8911e2-7315-4c66-af23-030604df9be4” } , “mendeley” : { “formattedCitation” : “38”, “plainTextFormattedCitation” : “38”, “previouslyFormattedCitation” : “38” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }38.6.4.1RASRAS is an endocrine system involved directly in regulating blood pressure directly acting on blood vessels and indirectly by stimulating salts and water reabsorption upon acting on the adrenal gland. RAS plays a major physiological role in regulating vascular function and further exerts a pathological role during vascular injury through its action on endothelial cells, vascular inflammation and remodelingADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48. Drugs that inhibit RAS reduce the risk of cardiovascular events and promote vascular health. Circulating renin produced primarily by the kidneys convert angiotensinogen derived from the liver into Ang I which is then cleaved by Angiotensin converting enzyme (ACE) to yield Ang II. Recent data suggest that renin is not only produced from the kidney and Ang along with its derived peptides production is not restricted to renal tissues rather they were found in other organs including the brain, pituitary gland, heart and vessels. In these organs, the system is referred to as local or tissue-based and its activity is elevated in variety of diseases such as diabetes, retinopathies, and cardiovascular diseasesADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-009-0020-y”, “ISBN” : “1534-3111”, “ISSN” : “15226417”, “PMID” : “19278599”, “abstract” : “Recently, several novel aspects of the renin-angiotensin system (RAS) were described, which potentially may change the therapeutic strategy to treat cardiovascular disease, in addition to enhancing understanding of this system’s mechanism of action. Most notably, identification of a functional intracellular RAS may address several unanswered questions regarding a direct role of angiotensin (Ang) II in cardiac remodeling and incomplete efficacy of angiotensin-converting enzyme inhibitors and angiotensin receptor blockers or superiority of a renin inhibitor in cardiovascular disorders. We describe the physiology of the intracellular RAS, potential pathologic roles of intracellular Ang II, and the relevance of the intracellular system in view of recent clinical trials involving various RAS inhibitors.”, “author” : { “dropping-particle” : “”, “family” : “Kumar”, “given” : “Rajesh”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Singh”, “given” : “Vivek P.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Baker”, “given” : “Kenneth M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2009” }, “page” : “104-110”, “title” : “The intracellular renin-angiotensin system in the heart”, “type” : “article”, “volume” : “11” }, “uris” : “http://www.mendeley.com/documents/?uuid=2c599f2e-eff4-4b48-95d0-728be2042765” } , “mendeley” : { “formattedCitation” : “49”, “plainTextFormattedCitation” : “49”, “previouslyFormattedCitation” : “49” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }49.6.4.2.Ang II receptors and signalingAng II mediates its effects via complex interaction with the two G-protein coupled receptors Angiotensin type I receptor (AT1R) orAngiotensin type 2 receptor (AT2R).AT1R mediates the pathophysiological effects of Ang II including vasoconstriction, inflammation, fibrosis and growth, however AT2R oppose AT1R-mediated actions thus promoting vasodilatation and apoptosisADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48.Binding of Ang II to its receptor AT1R results in the coupling of G proteins with the C terminal of the receptor leading to activation of multiple signaling pathways including phospholipase D (PLD), phospholipase C (PLC), Ca2+ channels, serine threonine kinases including MAP kinases and protein kinase C (PKC) and NADPH oxidaseADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48. Activation of PLC produces inositol-1, 4, 5-triphosphate (IP3) and diacylglycerol (DAG) within seconds. IP3 binds to its receptor on sarcoplasmic reticulum, opening Ca2+ channel that allows calcium efflux into the cytoplasm. Ca2+ binds to calmodulin and activates myosin light chain kinase (MLCK) enhancing the interaction between actin and myosin, causing SMC contraction. Myosin light chain phosphatase (MLCP) counter-regulate MLCK, and is inhibited by Rho kinase and thus vascular injury and hypertension are associated with increased activation of RhoA/Rho kinase activityADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1152/ajpcell.00287.2006.”, “ISBN” : “0363-6143 (Print)
0363-6143 (Linking)”, “ISSN” : “0363-6143”, “PMID” : “16870827”, “abstract” : “The renin-angiotensin system is a central component of the physiological and pathological responses of cardiovascular system. Its primary effector hormone, angiotensin II (ANG II), not only mediates immediate physiological effects of vasoconstriction and blood pressure regulation, but is also implicated in inflammation, endothelial dysfunction, atherosclerosis, hypertension, and congestive heart failure. The myriad effects of ANG II depend on time (acute vs. chronic) and on the cells/tissues upon which it acts. In addition to inducing G protein- and non-G protein-related signaling pathways, ANG II, via AT(1) receptors, carries out its functions via MAP kinases (ERK 1/2, JNK, p38MAPK), receptor tyrosine kinases PDGF, EGFR, insulin receptor, and nonreceptor tyrosine kinases Src, JAK/STAT, focal adhesion kinase (FAK). AT(1)R-mediated NAD(P)H oxidase activation leads to generation of reactive oxygen species, widely implicated in vascular inflammation and fibrosis. ANG II also promotes the association of scaffolding proteins, such as paxillin, talin, and p130Cas, leading to focal adhesion and extracellular matrix formation. These signaling cascades lead to contraction, smooth muscle cell growth, hypertrophy, and cell migration, events that contribute to normal vascular function, and to disease progression. This review focuses on the structure and function of AT(1) receptors and the major signaling mechanisms by which angiotensin influences cardiovascular physiology and pathology.”, “author” : { “dropping-particle” : “”, “family” : “Mehta”, “given” : “Puja K”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Griendling”, “given” : “Kathy K”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “American Journal of Physiology – Cell Physiology”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2007” }, “page” : “C82-C97”, “title” : “Angiotensin II cell signaling: physiological and pathological effects in the cardiovascular system”, “type” : “article-journal”, “volume” : “292” }, “uris” : “http://www.mendeley.com/documents/?uuid=d5863cf9-9a20-46f1-b249-71416c932605” } , “mendeley” : { “formattedCitation” : “50”, “plainTextFormattedCitation” : “50”, “previouslyFormattedCitation” : “50” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }50. PLD activation leads to PC hydrolysis into phosphatidic acid(PA) and choline.PA is converted into DAG sustaining contraction. The PLC/PLD pathways are augmented in hypertensive rats compared to control suggesting a role for their downstream signaling second messengers in the pathogenesis of hypertensionADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1152/ajpcell.00287.2006.”, “ISBN” : “0363-6143 (Print)
0363-6143 (Linking)”, “ISSN” : “0363-6143”, “PMID” : “16870827”, “abstract” : “The renin-angiotensin system is a central component of the physiological and pathological responses of cardiovascular system. Its primary effector hormone, angiotensin II (ANG II), not only mediates immediate physiological effects of vasoconstriction and blood pressure regulation, but is also implicated in inflammation, endothelial dysfunction, atherosclerosis, hypertension, and congestive heart failure. The myriad effects of ANG II depend on time (acute vs. chronic) and on the cells/tissues upon which it acts. In addition to inducing G protein- and non-G protein-related signaling pathways, ANG II, via AT(1) receptors, carries out its functions via MAP kinases (ERK 1/2, JNK, p38MAPK), receptor tyrosine kinases PDGF, EGFR, insulin receptor, and nonreceptor tyrosine kinases Src, JAK/STAT, focal adhesion kinase (FAK). AT(1)R-mediated NAD(P)H oxidase activation leads to generation of reactive oxygen species, widely implicated in vascular inflammation and fibrosis. ANG II also promotes the association of scaffolding proteins, such as paxillin, talin, and p130Cas, leading to focal adhesion and extracellular matrix formation. These signaling cascades lead to contraction, smooth muscle cell growth, hypertrophy, and cell migration, events that contribute to normal vascular function, and to disease progression. This review focuses on the structure and function of AT(1) receptors and the major signaling mechanisms by which angiotensin influences cardiovascular physiology and pathology.”, “author” : { “dropping-particle” : “”, “family” : “Mehta”, “given” : “Puja K”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Griendling”, “given” : “Kathy K”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “American Journal of Physiology – Cell Physiology”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2007” }, “page” : “C82-C97”, “title” : “Angiotensin II cell signaling: physiological and pathological effects in the cardiovascular system”, “type” : “article-journal”, “volume” : “292” }, “uris” : “http://www.mendeley.com/documents/?uuid=d5863cf9-9a20-46f1-b249-71416c932605” } , “mendeley” : { “formattedCitation” : “50”, “plainTextFormattedCitation” : “50”, “previouslyFormattedCitation” : “50” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }50.6.4.3.Ang II signaling through reactive oxygen speciesMany of the molecular and cellular effects of Ang II are mediated through the production of ROS. Of the various species generated: superoxide anion (•O2-), hydrogen peroxide (H2O2), and nitric oxide (NO) appear to be important in cardiovascular systemADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48. Vascular ROS are produced in the endothelium and VSMC from non-phagocytic NADPH oxidases (Nox 1, 4, 5). These are constitutively active and released ROS act as intracellular signaling molecules that activate transcription factors and other molecules involved in migration, inflammation, and fibrosis. Ang II is a potent stimulator of NADPH oxidase and stimulates the expression of its subunits. In several pathologies including atherosclerosis, diabetes and hypertension these processes are augmented consequently leading to oxidative stressADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.4061/2011/916310”, “ISSN” : “2090-0392”, “PMID” : “21747985”, “abstract” : “<p>Reactive oxygen species are oxygen derivates and play an active role in vascular biology. These compounds are generated within the vascular wall, at the level of endothelial and vascular smooth muscle cells, as well as by adventitial fibroblasts. In healthy conditions, ROS are produced in a controlled manner at low concentrations and function as signaling molecules regulating vascular contraction-relaxation and cell growth. Physiologically, the rate of ROS generation is counterbalanced by the rate of elimination. In hypertension, an enhanced ROS generation occurs, which is not counterbalanced by the endogenous antioxidant mechanisms, leading to a state of oxidative stress. In the present paper, major angiotensin II-induced vascular ROS generation within the vasculature, and relative sources, will be discussed. Recent development of signalling pathways whereby angiotensin II-driven vascular ROS induce and accelerate functional and structural vascular injury will be also considered.</p>”, “author” : { “dropping-particle” : “”, “family” : “Virdis”, “given” : “Agostino”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Duranti”, “given” : “Emiliano”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Taddei”, “given” : “Stefano”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “International Journal of Hypertension”, “id” : “ITEM-1”, “issued” : { “date-parts” : “2011” }, “page” : “1-7”, “title” : “Oxidative Stress and Vascular Damage in Hypertension: Role of Angiotensin II”, “type” : “article-journal”, “volume” : “2011” }, “uris” : “http://www.mendeley.com/documents/?uuid=df1238b1-fc25-4ecd-9b43-0f5c001a23cb” } , “mendeley” : { “formattedCitation” : “51”, “plainTextFormattedCitation” : “51”, “previouslyFormattedCitation” : “51” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }51.•O2- and H2O2 activate multiple signaling molecules including tyrosine kinases, tyrosine phosphatases, MAP kinases, calcium channels and transcription factors including NF-?B and Activator protein 1(AP-1)ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1590/S0100-879X2004000800018”, “ISSN” : “0100-879X”, “PMID” : “15273829”, “abstract” : “Diseases such as hypertension, atherosclerosis, hyperlipidemia, and diabetes are associated with vascular functional and structural changes including endothelial dysfunction, altered contractility and vascular remodeling. Cellular events underlying these processes involve changes in vascular smooth muscle cell (VSMC) growth, apoptosis/anoikis, cell migration, inflammation, and fibrosis. Many factors influence cellular changes, of which angiotensin II (Ang II) appears to be amongst the most important. The physiological and pathophysiological actions of Ang II are mediated primarily via the Ang II type 1 receptor. Growing evidence indicates that Ang II induces its pleiotropic vascular effects through NADPH-driven generation of reactive oxygen species (ROS). ROS function as important intracellular and intercellular second messengers to modulate many downstream signaling molecules, such as protein tyrosine phosphatases, protein tyrosine kinases, transcription factors, mitogen-activated protein kinases, and ion channels. Induction of these signaling cascades leads to VSMC growth and migration, regulation of endothelial function, expression of pro-inflammatory mediators, and modification of extracellular matrix. In addition, ROS increase intracellular free Ca2+ concentration (Ca2+i), a major determinant of vascular reactivity. ROS influence signaling molecules by altering the intracellular redox state and by oxidative modification of proteins. In physiological conditions, these events play an important role in maintaining vascular function and integrity. Under pathological conditions ROS contribute to vascular dysfunction and remodeling through oxidative damage. The present review focuses on the biology of ROS in Ang II signaling in vascular cells and discusses how oxidative stress contributes to vascular damage in cardiovascular disease.”, “author” : { “dropping-particle” : “”, “family” : “Touyz”, “given” : “R.M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Brazilian Journal of Medical and Biological Research”, “id” : “ITEM-1”, “issue” : “8”, “issued” : { “date-parts” : “2004” }, “page” : “1263-1273”, “title” : “Reactive oxygen species and angiotensin II signaling in vascular cells: implications in cardiovascular disease”, “type” : “article-journal”, “volume” : “37” }, “uris” : “http://www.mendeley.com/documents/?uuid=ff357fa1-1af0-4a8b-aabe-98262d5ea1e2” } , “mendeley” : { “formattedCitation” : “52”, “plainTextFormattedCitation” : “52”, “previouslyFormattedCitation” : “52” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }52. Once activated, these molecules participate in cell growth, contraction, production of extracellular matrix proteins, and expression of pro-inflammatory genes all contributing to vascular injuryADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48. In Ang II hypertensive rats; treatment with superoxide dismutase (SOD) mimetics reduce the release of vascular ROS and regress vascular remodelingADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-003-0073-2”, “ISBN” : “1522-6417 (Print)”, “ISSN” : “1522-6417”, “PMID” : “12642016”, “abstract” : “A major hemodynamic abnormality in hypertension is increased peripheral resistance due to changes in vascular structure and function. Structural changes include reduced lumen diameter and arterial wall thickening. Functional changes include increased vasoconstriction and/or decreased vasodilation. These processes are influenced by many humoral factors, of which angiotensin II (Ang II) seems to be critical. At the cellular level, Ang II stimulates vascular smooth muscle cell growth, increases collagen deposition, induces inflammation, increases contractility, and decreases dilation. Molecular mechanisms associated with these changes in hypertension include upregulation of many signaling pathways, including tyrosine kinases, mitogen-activated protein kinases, RhoA/Rho kinase, and increased generation of reactive oxygen species. This review focuses on the role of Ang II in vascular functional and structural changes of small arteries in hypertension. In addition, cellular processes whereby Ang II influences vessels in hypertension are discussed. Finally, novel concepts related to signaling pathways by which Ang II regulates vascular smooth muscle cells in hypertension are introduced.”, “author” : { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current hypertension reports”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2003” }, “page” : “155-164”, “title” : “The role of angiotensin II in regulating vascular structural and functional changes in hypertension.”, “type” : “article-journal”, “volume” : “5” }, “uris” : “http://www.mendeley.com/documents/?uuid=0d9e5218-7de0-401a-a019-e09e1c700cc8” } , “mendeley” : { “formattedCitation” : “47”, “plainTextFormattedCitation” : “47”, “previouslyFormattedCitation” : “47” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }47. Clinical studies suggest an antioxidant effect of AT1R blockers as hypertensive patients show reduced inflammation and oxidative stress when treated with candesartanADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48.6.4.4.Ang II, vascular remodeling and calcificationVSMC as mentioned previously are highly plastic cells that contribute to arterial remodeling by affecting cell growth, apoptosis, inflammation and fibrosis. Ang II promotes phenotypic switching from a contractile phenotype to a secretory phenotype by influencing the contractile machinery, cell hypertrophy and proliferation, and the secretion of mitogenic, inflammatory and fibrotic mediatorsADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48(Figure 4).VC is one of the complex processes that involve arterial remodeling and the trasndifferentiation of VSMC into osteoblast-like cells. Ang II influences largely numerous events that induce VC. It stimulates the expression of master regulators andtranscription factors of osteogenic differentiation such as BMP-2 and Runx-2. In addition, Ang II reduces the expression of inhibitors of calcification such as MGPADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1152/ajpheart.00826.2011”, “ISBN” : “1522-1539 (Electronic)
0363-6135 (Linking)”, “ISSN” : “1522-1539”, “PMID” : “22796540”, “abstract” : “Vascular calcification predicts an increased risk for cardiovascular events in atherosclerosis, diabetes, and end-stage kidney diseases. Matrix Gla protein (MGP), an inhibitor of calcification, limits calcium phosphate deposition in the vessel wall. There are many factors contributing to the progression of atherosclerosis, including hypertension, hyperlipidemia, the renin-angiotensin system, and inflammation. Angiotensin II (ANG II) plays a crucial role in the atherogenic process through not only its pressor responses but also its growth-promoting and inflammatory effects. In this study, we investigated the role of MGP in ANG II-induced exacerbation of vascular calcification in human vascular smooth muscle cells (VSMCs). The expression of MGP, calcification, and apoptosis in human VSMCs were examined by Western blot analysis, real-time PCR, in situ terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling, and enzyme-linked immunosorbent assay, respectively. Increase in VSMC calcification in human atherosclerotic plaques upregulates MGP expression and apoptosis in a negative feedback manner. ANG II inhibited MGP expression in VSMCs via and in vitro in a dose- and time-dependent manner through ANG II type 1 receptor and NF-u03baB signaling pathway. Meanwhile, MGP inhibited the calcification, caspase-3 activity, activation of runt-related transcription factor 2, and release of inflammatory cytokines by VSMCs induced by calcification medium (2.5 mM P(i)) and ANG II in vitro. These observations provide evidence that ANG II exacerbates vascular calcification through activation of the transcription factors, runt-related transcription factor 2 and NF-u03baB, and regulation of MGP, inflammatory cytokines expression in human VSMCs.”, “author” : { “dropping-particle” : “”, “family” : “Jia”, “given” : “Guanghong”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Stormont”, “given” : “Ryan M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Gangahar”, “given” : “Deepak M”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Agrawal”, “given” : “Devendra K”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “American journal of physiology. Heart and circulatory physiology”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2012” }, “page” : “H523-32”, “title” : “Role of matrix Gla protein in angiotensin II-induced exacerbation of vascular calcification.”, “type” : “article-journal”, “volume” : “303” }, “uris” : “http://www.mendeley.com/documents/?uuid=43ddf1de-986b-4d20-ba8a-0fc75a5ec403” } , “mendeley” : { “formattedCitation” : “53”, “plainTextFormattedCitation” : “53”, “previouslyFormattedCitation” : “53” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }53.Moreover, Ang II stimulates the expression of lectin like oxidized LDL receptor-1 (LOX-1) that is expressed at the surface of endothelial cells and VSMC. The interaction between the oxLDL and LOX-1 enhances the production of inflammatory cytokines from VSMC and the production of fibrous cap present in advanced atherosclerotic plaques that frequently become calcifiedADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48.Arterial calcification was inhibited in rabbits fed with atherogenic diet then treated with AT1R blocker olmesartan medoxomilADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1093/cvr/cvq391”, “ISBN” : “1755-3245 (Electronic)
0008-6363 (Linking)”, “ISSN” : “00086363”, “PMID” : “21156821”, “abstract” : “AIMS: Arterial calcification is a common complication of several disorders and is a strong predictor of mortality. The mechanism underlying arterial calcification is not fully understood and as such, no pharmaceutical therapies are currently available which impede its progression. The aim of this study was to investigate the effects of an angiotensin II (AngII) type 1 receptor blocker (ARB) on arterial calcification.
METHODS AND RESULTS: Male New Zealand White rabbits were fed an atherogenic diet to induce atherosclerosis and arterial calcification over a period of 12 weeks, with an ARB administered in the final 4 weeks. Using clinically relevant micro-computed tomography, we found that animals fed the atherogenic diet displayed extensive arterial calcification when compared with control. In contrast, administration of the ARB completely inhibited calcification (2.80 u00b1 1.17 vs. 0.01 u00b1 0.01% calcified tissue in cholesterol and ARB-treated, respectively; n = 6 and 5; P < 0.05). Calcified regions were characterized by up-regulation of bone morphogenetic protein 2, osteocalcin, and the AngII type 1 receptor and concomitant down-regulation of u03b1-smooth muscle actin, consistent with a phenotypic switch from vascular to osteoblast-like cells.
CONCLUSION: These data provide the first evidence that angiotensin receptor blockade can inhibit arterial calcification by disrupting vascular osteogenesis and suggest that ARBs may be a novel treatment option for patients suffering from vascular calcification.”, “author” : { “dropping-particle” : “”, “family” : “Armstrong”, “given” : “Zachary B.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Boughner”, “given” : “Derek R.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Drangova”, “given” : “Maria”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rogers”, “given” : “Kem A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular Research”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2011” }, “page” : “165-170”, “title” : “Angiotensin II type 1 receptor blocker inhibits arterial calcification in a pre-clinical model”, “type” : “article-journal”, “volume” : “90” }, “uris” : “http://www.mendeley.com/documents/?uuid=d9056f87-238d-405a-8449-06eb9f53a316” } , “mendeley” : { “formattedCitation” : “46”, “plainTextFormattedCitation” : “46”, “previouslyFormattedCitation” : “46” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }46. In addition Losartan inhibits VC in a rat model treated with warfarin and vitamin k to induce VC and reduce the mRNA and protein expression of BMP2 and Runx-2 compared to groups with VC who did not receive the drugADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s12012-015-9326-y”, “ISSN” : “15590259”, “PMID” : “25896298”, “abstract” : “The blockade of renin-angiotensin II system has been shown to reduce morbidity and mortality in hypertension, atherosclerosis, diabetes and chronic kidney disease. Since vascular calcification (VC) is commonly found in these diseases, the aim of this study was to examine whether or not losartan, a widely used angiotensin II receptor blockers, inhibits VC in rats in vivo. A rat model of VC was generated by treating rats with a combination of warfarin and vitamin K1. Two weeks after the treatments, the rats were treated with vehicle or without losartan (100 ng/kg/day) for 2 weeks. At the end of the experiments, aortic arteries were isolated for the examination of calcification morphology, mRNA and protein expression of BMP2 and Runx2, and osteoblast differentiation. Warfarin and vitamin K instigated vascular remodeling with calcified plaques in the aortic arteries in rats. Losartan significantly attenuated warfarin- and vitamin K-induced vascular injury and calcification. Consistently, losartan suppressed the levels of mRNA and protein expression of BMP2 and Runx2, two key factors for VC. Further, vascular calcified lesion areas expressed angiotensin II 1 receptor (AT1R). Finally, losartan treatment significantly inhibited apoptosis in vascular smooth muscle cell (VSMC) in rat arteries. We conclude that losartan suppresses VC by lowering the expression of AT1R, Runx2 and BMP2, and by inhibiting the apoptosis of VSMC in rat aortic arteries.”, “author” : { “dropping-particle” : “”, “family” : “Li”, “given” : “Mincai”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Wu”, “given” : “Panfeng”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shao”, “given” : “Juan”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Ke”, “given” : “Zhiqiang”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Li”, “given” : “Dan”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Wu”, “given” : “Jiliang”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Cardiovascular Toxicology”, “id” : “ITEM-1”, “issue” : “2”, “issued” : { “date-parts” : “2016” }, “page” : “172-181”, “title” : “Losartan Inhibits Vascular Calcification by Suppressing the BMP2 and Runx2 Expression in Rats In Vivo”, “type” : “article-journal”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=02642faa-68d3-4ac3-b500-07dc28c8b737” } , “mendeley” : { “formattedCitation” : “54”, “plainTextFormattedCitation” : “54”, “previouslyFormattedCitation” : “54” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }54.138430104140Figure 4: Mechanisms whereby Ang II induces vascular injury.ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }487.AutophagyAutophagy is a self degradative process essential for maintenance of cellular homeostasis via the removal of damaged organelles and misfolded proteins and act as a survival mechanism for cells during nutrient stress thus balancing the sources of energyADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1002/path.2697.Autophagy”, “ISBN” : “0022-3417
1096-9896”, “ISSN” : “10969896”, “PMID” : “20225336”, “abstract” : “Autophagy is a self-degradative process that is important for balancing sources of energy at critical times in development and in response to nutrient stress. Autophagy also plays a housekeeping role in removing misfolded or aggregated proteins, clearing damaged organelles, such as mitochondria, endoplasmic reticulum and peroxisomes, as well as eliminating intracellular pathogens. Thus, autophagy is generally thought of as a survival mechanism, although its deregulation has been linked to non-apoptotic cell death. Autophagy can be either non-selective or selective in the removal of specific organelles, ribosomes and protein aggregates, although the mechanisms regulating aspects of selective autophagy are not fully worked out. In addition to elimination of intracellular aggregates and damaged organelles, autophagy promotes cellular senescence and cell surface antigen presentation, protects against genome instability and prevents necrosis, giving it a key role in preventing diseases such as cancer, neurodegeneration, cardiomyopathy, diabetes, liver disease, autoimmune diseases and infections. This review summarizes the most up-to-date findings on how autophagy is executed and regulated at the molecular level and how its disruption can lead to disease. Copyright (c) 2010 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.”, “author” : { “dropping-particle” : “”, “family” : “Glick”, “given” : “Danielle”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Barth”, “given” : “Sandra”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Macleod”, “given” : “Kay F”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Pathology The”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2010” }, “page” : “3-12”, “title” : “Autophagy : cellular and molecular mechanisms”, “type” : “article-journal”, “volume” : “221” }, “uris” : “http://www.mendeley.com/documents/?uuid=3065d7ba-1308-48e9-866e-77b7eb23e948” } , “mendeley” : { “formattedCitation” : “55”, “plainTextFormattedCitation” : “55”, “previouslyFormattedCitation” : “55” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }55. Autophagy starts by the formation of the phagophore membrane of lipid bilayer nature derived from the ER and then the engulfment of the intracellular cargo followed by the fusion with the lysosome so that engulfed materials are sentenced to be degraded by the lysosome acid- hydrolases. Upon degradation by anabolic pathways, large macromolecules are provided to sustain energy level and to provide raw materials for synthesis of higher ordered structures (nucleic acids, proteins…) ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1172/JCI73943”, “ISBN” : “1558-8238 (Electronic)
0021-9738 (Linking)”, “ISSN” : “15588238”, “PMID” : “25654551”, “abstract” : “Cardiovascular disease is the leading cause of death worldwide. As such, there is great interest in identifying novel mechanisms that govern the cardiovascular response to disease-related stress. First described in failing hearts, autophagy within the cardiovascular system has been widely characterized in cardiomyocytes, cardiac fibroblasts, endothelial cells, vascular smooth muscle cells, and macrophages. In all cases, a window of optimal autophagic activity appears to be critical to the maintenance of cardiovascular homeostasis and function; excessive or insufficient levels of autophagic flux can each contribute to heart disease pathogenesis. In this Review, we discuss the potential for targeting autophagy therapeutically and our vision for where this exciting biology may lead in the future.”, “author” : { “dropping-particle” : “”, “family” : “Lavandero”, “given” : “Sergio”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Chiong”, “given” : “Mario”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rothermel”, “given” : “Beverly A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Hill”, “given” : “Joseph A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Clinical Investigation”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2015” }, “page” : “55-64”, “title” : “Autophagy in cardiovascular biology”, “type” : “article”, “volume” : “125” }, “uris” : “http://www.mendeley.com/documents/?uuid=6fb9b75b-fe7c-46a7-803d-c5e892e22c6b” } , “mendeley” : { “formattedCitation” : “56”, “plainTextFormattedCitation” : “56”, “previouslyFormattedCitation” : “56” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }56. Defects in autophagy demonstrate the importance of this process in physiological and pathological conditions and this was proved by Autophagy knockout animal models. For instance, mutations in ATG16L1,an important component of autophagic machinery required for the multimerization of the phagophore membrane, has been linked to the susceptibility to Chron’s diseaseADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1038/cr.2013.161”, “ISBN” : “1551-4005 (Electronic)
1551-4005 (Linking)”, “ISSN” : “15384101”, “PMID” : “17671424”, “abstract” : “Autophagy is a major intracellular degradative process that delivers cytoplasmic materials to the lysosome for degradation. Since the discovery of autophagy-related (Atg) genes in the 1990s, there has been a proliferation of stud-ies on the physiological and pathological roles of autophagy in a variety of autophagy knockout models. However, di-rect evidence of the connections between ATG gene dysfunction and human diseases has emerged only recently. There are an increasing number of reports showing that mutations in the ATG genes were identified in various human diseases such as neurodegenerative diseases, infectious diseases, and cancers. Here, we review the major advances in identification of mutations or polymorphisms of the ATG genes in human diseases. Current autophagy-modulating compounds in clinical trials are also summarized.”, “author” : { “dropping-particle” : “”, “family” : “Jiang”, “given” : “Peidu”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Mizushima”, “given” : “Noboru”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nature Publishing Group”, “id” : “ITEM-1”, “issue” : “24”, “issued” : { “date-parts” : “2013” }, “page” : “69-7969”, “title” : “Autophagy and human diseases”, “type” : “article-journal”, “volume” : “24” }, “uris” : “http://www.mendeley.com/documents/?uuid=262006d5-e6fe-4ba7-af74-f4e817ae9bba” } , “mendeley” : { “formattedCitation” : “57”, “plainTextFormattedCitation” : “57”, “previouslyFormattedCitation” : “57” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }57. In addition, Lysosome associated membrane protein 2(LAMP-2) plays an important role in the third type of Autophagy that is chaperone-mediated Autophagy and in the fusion of the phagosome with the lysosome for autolysosme formation. Mutations in the gene encoding this protein lead to genetic lesions in Danon disease that cause cardiomyocyte hypertrophyADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1002/path.2697.Autophagy”, “ISBN” : “0022-3417
1096-9896”, “ISSN” : “10969896”, “PMID” : “20225336”, “abstract” : “Autophagy is a self-degradative process that is important for balancing sources of energy at critical times in development and in response to nutrient stress. Autophagy also plays a housekeeping role in removing misfolded or aggregated proteins, clearing damaged organelles, such as mitochondria, endoplasmic reticulum and peroxisomes, as well as eliminating intracellular pathogens. Thus, autophagy is generally thought of as a survival mechanism, although its deregulation has been linked to non-apoptotic cell death. Autophagy can be either non-selective or selective in the removal of specific organelles, ribosomes and protein aggregates, although the mechanisms regulating aspects of selective autophagy are not fully worked out. In addition to elimination of intracellular aggregates and damaged organelles, autophagy promotes cellular senescence and cell surface antigen presentation, protects against genome instability and prevents necrosis, giving it a key role in preventing diseases such as cancer, neurodegeneration, cardiomyopathy, diabetes, liver disease, autoimmune diseases and infections. This review summarizes the most up-to-date findings on how autophagy is executed and regulated at the molecular level and how its disruption can lead to disease. Copyright (c) 2010 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.”, “author” : { “dropping-particle” : “”, “family” : “Glick”, “given” : “Danielle”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Barth”, “given” : “Sandra”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Macleod”, “given” : “Kay F”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Pathology The”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2010” }, “page” : “3-12”, “title” : “Autophagy : cellular and molecular mechanisms”, “type” : “article-journal”, “volume” : “221” }, “uris” : “http://www.mendeley.com/documents/?uuid=3065d7ba-1308-48e9-866e-77b7eb23e948” } , “mendeley” : { “formattedCitation” : “55”, “plainTextFormattedCitation” : “55”, “previouslyFormattedCitation” : “55” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }55. It’s now obvious that disruption in the autophagic flux play either a protective or a destructive role in numerous diseases and drugs interfering with various stages of the process are gaining considerable attention. Autophagy modulating drugs such as chloroquine and Carbamazepine are now in clinical trialsADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1038/cr.2013.161”, “ISBN” : “1551-4005 (Electronic)
1551-4005 (Linking)”, “ISSN” : “15384101”, “PMID” : “17671424”, “abstract” : “Autophagy is a major intracellular degradative process that delivers cytoplasmic materials to the lysosome for degradation. Since the discovery of autophagy-related (Atg) genes in the 1990s, there has been a proliferation of stud-ies on the physiological and pathological roles of autophagy in a variety of autophagy knockout models. However, di-rect evidence of the connections between ATG gene dysfunction and human diseases has emerged only recently. There are an increasing number of reports showing that mutations in the ATG genes were identified in various human diseases such as neurodegenerative diseases, infectious diseases, and cancers. Here, we review the major advances in identification of mutations or polymorphisms of the ATG genes in human diseases. Current autophagy-modulating compounds in clinical trials are also summarized.”, “author” : { “dropping-particle” : “”, “family” : “Jiang”, “given” : “Peidu”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Mizushima”, “given” : “Noboru”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Nature Publishing Group”, “id” : “ITEM-1”, “issue” : “24”, “issued” : { “date-parts” : “2013” }, “page” : “69-7969”, “title” : “Autophagy and human diseases”, “type” : “article-journal”, “volume” : “24” }, “uris” : “http://www.mendeley.com/documents/?uuid=262006d5-e6fe-4ba7-af74-f4e817ae9bba” } , “mendeley” : { “formattedCitation” : “57”, “plainTextFormattedCitation” : “57”, “previouslyFormattedCitation” : “57” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }577.1.Autophagy and vascular biologyThere is increasing interest in the role of autophagy in vascular biology as its dysregulation was shown to be associated with a wide array of abnormal vascular processes and pathologiesADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1172/JCI73943”, “ISBN” : “1558-8238 (Electronic)
0021-9738 (Linking)”, “ISSN” : “15588238”, “PMID” : “25654551”, “abstract” : “Cardiovascular disease is the leading cause of death worldwide. As such, there is great interest in identifying novel mechanisms that govern the cardiovascular response to disease-related stress. First described in failing hearts, autophagy within the cardiovascular system has been widely characterized in cardiomyocytes, cardiac fibroblasts, endothelial cells, vascular smooth muscle cells, and macrophages. In all cases, a window of optimal autophagic activity appears to be critical to the maintenance of cardiovascular homeostasis and function; excessive or insufficient levels of autophagic flux can each contribute to heart disease pathogenesis. In this Review, we discuss the potential for targeting autophagy therapeutically and our vision for where this exciting biology may lead in the future.”, “author” : { “dropping-particle” : “”, “family” : “Lavandero”, “given” : “Sergio”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Chiong”, “given” : “Mario”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rothermel”, “given” : “Beverly A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Hill”, “given” : “Joseph A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Clinical Investigation”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2015” }, “page” : “55-64”, “title” : “Autophagy in cardiovascular biology”, “type” : “article”, “volume” : “125” }, “uris” : “http://www.mendeley.com/documents/?uuid=6fb9b75b-fe7c-46a7-803d-c5e892e22c6b” } , “mendeley” : { “formattedCitation” : “56”, “plainTextFormattedCitation” : “56”, “previouslyFormattedCitation” : “56” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }56. Autophagy has widely been characterized in cardiovascular system including cardiomyocytes, endothelial cells, and VSMCs. Optimal autophagic flux is required for the maintenance of cardiac homeostasis as excessive or insufficient levels contribute to heart diseases. A growing body of literature suggests that the loss of autophagy contribute to endothelial dysfunction. Diabetes for instance triggers vascular injury via multiple signaling pathways activated by a high glucose level and by Ang II. In vitro studies demonstrate a protective effect of autophagy from detrimental effects of Ang II and limiting glucose induced endothelial damageADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/CIRCRESAHA.116.303805”, “ISSN” : “15244571”, “PMID” : “25634971”, “abstract” : “There is increasing interest in the role of autophagic flux in maintaining normal vessel wall biology and a growing suspicion that autophagic dysregulation may be a common pathway through which vascular aging and associated pathologies develop. Within endothelial and smooth muscle cells, diverse but important triggers that range from oxidized lipids to u03b2-amyloid seem to stimulate autophagosome formation potently. In addition, emerging evidence links autophagy to a wide array of vascular processes ranging from angiogenesis to calcification of the vessel wall. Alterations in autophagic flux are also increasingly being implicated in disease processes that include both atherosclerosis and pulmonary hypertension. Finally, recent insights point toward an important role of autophagy in the paracrine regulation of vasoactive substances from the endothelium. Here, we review the progress in understanding how autophagy can contribute to vascular biology and the emerging strategies to target this process for therapeutic benefit.”, “author” : { “dropping-particle” : “”, “family” : “Nussenzweig”, “given” : “Samuel C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Verma”, “given” : “Subodh”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Finkel”, “given” : “Toren”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Circulation Research”, “id” : “ITEM-1”, “issue” : “3”, “issued” : { “date-parts” : “2015” }, “page” : “480-488”, “title” : “The role of autophagy in vascular biology”, “type” : “article”, “volume” : “116” }, “uris” : “http://www.mendeley.com/documents/?uuid=a2848471-8094-4038-808f-8d51b143784f” } , “mendeley” : { “formattedCitation” : “58”, “plainTextFormattedCitation” : “58”, “previouslyFormattedCitation” : “58” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }58 . The addition of platelet derived growth factor PDGF to VSMC induce VSMC switching into a synthetic phenotype and induce autophagy. Pharmacological inhibition of autophagy on the other hand, inhibits the effect of platelet derived growth factor (PDGF) on SMC phenotypic switching thus VSMC switching is associated with autophagy. Autophagy modulates SMC biology also in calcification. In vitro TGF-? induced calcification was suppressed by VSMC treatment with atorvastatin upon induction of autophagyADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1172/JCI73943”, “ISBN” : “1558-8238 (Electronic)
0021-9738 (Linking)”, “ISSN” : “15588238”, “PMID” : “25654551”, “abstract” : “Cardiovascular disease is the leading cause of death worldwide. As such, there is great interest in identifying novel mechanisms that govern the cardiovascular response to disease-related stress. First described in failing hearts, autophagy within the cardiovascular system has been widely characterized in cardiomyocytes, cardiac fibroblasts, endothelial cells, vascular smooth muscle cells, and macrophages. In all cases, a window of optimal autophagic activity appears to be critical to the maintenance of cardiovascular homeostasis and function; excessive or insufficient levels of autophagic flux can each contribute to heart disease pathogenesis. In this Review, we discuss the potential for targeting autophagy therapeutically and our vision for where this exciting biology may lead in the future.”, “author” : { “dropping-particle” : “”, “family” : “Lavandero”, “given” : “Sergio”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Chiong”, “given” : “Mario”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rothermel”, “given” : “Beverly A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Hill”, “given” : “Joseph A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Clinical Investigation”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2015” }, “page” : “55-64”, “title” : “Autophagy in cardiovascular biology”, “type” : “article”, “volume” : “125” }, “uris” : “http://www.mendeley.com/documents/?uuid=6fb9b75b-fe7c-46a7-803d-c5e892e22c6b” } , “mendeley” : { “formattedCitation” : “56”, “plainTextFormattedCitation” : “56”, “previouslyFormattedCitation” : “56” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }56.Aim of the ProjectCardiovascular diseases, such as hypertension, atherosclerosis, and heart failure, are associated with modification in the Renin-Angiotensin-Aldosterone System (RAAS). Regardless of the difference in the nature of the disease, treatment with drugs inhibiting RAAS has been shown to reduce cardiovascular events. Since hypercholesteremia is often associated with hypertension, a large number of patients receive statins in combination with antihypertensive drugs. Numerous in vivo and in vitro studies suggest that statins boost the efficacy of RAAS inhibitors. Statins exert a wide spectrum of biological effects among which are non-lipid-dependent ones and has been found to ameliorate the Ang II mediated vascular injury by several mechanisms most prominently through reducing oxidative stress and inflammation. Due to the implication of autophagy in cardiovascular physiology and pathology, it is important to determine whether this process act as an inducible or protective mechanism in case of vascular calcification. The aim of the present study is:To assess the effect of Ang II treatment on vascular calcification after 72 hrs incubation. To determine whether statins at this early stage of calcification are able to reduce or inhibit Ang II mediated detrimental effects in the present rat hypertensive model. To investigate the role of autophagy in statin mediated inhibition of Ang II detrimental effects on vascular injury by adding autophagy inhibitor and observes the progression of vascular calcification.Chapter II: Materials and methods1.Animals and experimental protocolThis study was approved by the Institutional Animal Care and Use Committee (IACUC) of the American University of Beirut (AUB). Male Sprague-Dawley rats weighing 200-250 g were obtained from Charles River Laboratories and maintained in the animal care facility at AUB. 2.Experimental DesignRats were sacrificed by CO2 inhalation and the aortic arches were isolated and dissected. Arches were cultured in DMEM (Dulbecco’s Modified Eagle Medium) supplemented with 10% FBS, and 5% penicillin/streptomycin. A set of two groups: control and Angiotensin II treated (10-6 µM) were incubated at 37°C in a humidified atmosphere with 5% CO2 for 72 hours. Medium with or without angiotensin was changed every 24 hours.Aortic arches used for histological analysis were embedded in optimal cutting temperature compound (OCT) compound and frozen in liquid nitrogen cooled-isopentane for subsequent cutting by microtome-cryostat into 5?m thickness then stored at -80°C. Arches used for RNA analysis were snap frozen in liquid nitrogen then stored at -80°C.3.Von kossa stainingFrozen cross sections were stained using the von kossa method to demonstrate deposits of soluble and insoluble calcium salts. Slides were incubated with 5% silver nitrate for 1 hour under the UV light. Unreacted silver was removed with 5% sodium thiosulfate. Slides were counterstained with safranin then dehydrated. Tissue images were visualized by Laser Microdissection (LMD) microscope (Leica microsystems, Cambridge, UK) at 20x magnification.4.Alizarin Red S Frozen sections were incubated with 1% Alizarin Red S (pH=4.2) at room temperature in dark for 30 min to stain calcium phosphate salts. Slides were observed by LMD microscope at 20x magnification.5.DHE experimentThe ROS generation in aortic arches was evaluated by the DHE staining method (Calbiochem, Darmstadt, Germany). Dihydroethidium (DHE) is a membrane permeable probe when oxidized leads to the generation of several florescent products among which are 2-hyroxyethidium which is specific for superoxide, and ethidium which is not specific for a particular ROS. These products intercalates into the DNA and fluoresces red. Briefly, 300?l of 10?M concentrated DHE were applied to frozen aortic arches sections and incubated in a light protected humidified chamber for 30 min at 37°C.Then 12?l of mounting solution (Thermofisher, ProLong™ Gold Antifade Mountant with DAPI) was added. The nuclei of the tissues were stained with DAPI (4′,6-Diamidino-2-Phenylindole, Dilactate), a blue fluorescent nucleic acid stain which bind the minor groove AT clusters, present within the mounting solution. Slides were then covered with cover slips and left to dry. Images of tissues were taken using Microscope Zeiss Axio (Leica microsystems, Cambridge, UK). Zen was used to quantify the intensity of the Fluorescence of DHE. Control was used as a reference.6.RNA Extraction500 ?L QIAzol (QIAGEN, 79306) was added to the crushed frozen aortic arches and incubated at room temperature for nucleoprotein complex dissociation. 100 ?L chloroform was then added to samples, followed by vigorous shaking for 15 seconds and incubated for 10 min at room temperature. Samples were centrifuged at 12000 x g for 10 min at 4°C. Three distinct phases were obtained: a lower red organic phase, a white interphase and a colorless aqueous upper phase, the resulting clear supernatant contain the RNA .The aqueous phase was transferred into a new micro-centrifuge tube and RNA was precipitated by 250 ?L isopropanol. The tubes were inverted several times, and then incubated 5-10 min at room temperature. Samples were centrifuged at 12000 x g for 10 min at 4°C and supernatant was aspirated. The pellet was washed with 75 % ethanol and centrifuged at 7500 x g for 5 min at 4°C. The supernatant was aspirated, the pellet was air dried and resuspended in 20 ?L DEPC water. RNA samples were incubated for 10-15 min at 55-60°C, then allowed to quench on ice. The resulting RNA was quantified using Nanodrop (Thermo Fisher Scientific)7.Reverse transcription-PCR:1 ?g of total RNA were reversed transcribed(Thermo Fischer Scientific, 00407363) using the RT-PCR machine (Bio-Rad Laboratories, California, USA). The cycle begins at 25°C for 10 min, 37°C for 2 hours, 85°C for 5 min, and ends at 4°C. The cDNA samples were stored at -20°C.8.Real-Time PCRReal-time PCR reactions were performed using CFX384 system (Bio-Rad Laboratories, California, USA) with iTaq™ Universal SYBR® Green supermix (Bio-Rad Laboratories, California, USA). The plate was run for 56 cycles. The first cycle was run at 94°C for 15 min followed by 55 cycles each at 94°C for 15 seconds, 56°C for 20 seconds, and finally 72°C for 30 seconds. Melting curves were evaluated to check for primer specificity for the PCR product and the results were quantified and analyzed using the Delta-Delta CT method. The primer sequences are listed in Table 2 .The housekeeping gene 18S rRNA was used for normalization.Target genes Forward primer Reverse primer18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCGOsteopontin(OPN) TATCAAGGTCATCCCAGTTGCCC ATCCAGCTGACTTGACTTGACTOsteocalcin(OCN) GGTGCAGACCTAGCAGACACCA AGGTAGCGCAGTCTATTCAIL-6 TTCTCTCCGCAAGAGACTTCC TCTCCTCTCCGACTTGTGAATNF-? ATGGGCTCCCTCTCATCAGT GCTTGGTGGTTTGCTACGACPLD1 TCCCAACTGAGATCTGGACGTAAAGG ACCTGCCTCTCATCTCTGGATCATACACTable 2: List of primers used in qRT-PCR.9.Statistical analysisExperiments were performed in triplicates and repeated for three independent experiments. Results are expressed as mean±SEM. Statistical comparisons were performed using the unpaired t-test. The p values for p<0.05 and p<0.01, (*, ** respectively) were considered significant. Prism software was used to perform statistical analysis.Chapter III: Results1-Ang II induces aortic arch calcification after 72 hrs incubation (Alizarin Red S and Von Kossa)In order to evaluate the effect of Ang II treatment for 72 hrs on aortic arch calcification, Alizarin Red and Von Kossa staining methods were performed. The results obtained by Von Kossa staining show the calcified regions as brown-black deposit in treated groups compared to control (figure 5A). Consistent with these results, Alizarin Red S staining revealed the presence of alizarin red precipitates in treated aortic arches compared to untreated ones (figure 5B) which imply prominent calcified lesions in the intima and more announced lesions in the media in treated groups compared to control. Control Ang II 27152555192644577558340A4373222038992713984229412BFigure 5: Aortic arch calcification induced by 72 hrs incubation with Ang II. (A) Von Kossa and (B) Alizarin Red S staining of aortic arch sections. Calcium deposition was observed in Ang II treated groups but not in control ones. Pictures were taken at 20X..2-Ang II induces ROS production after 72 hrs incubationDHE staining was performed for detecting ROS generation. The results obtained show a significant increase red staining in Ang II treated arches compared to control group(p<0.01)(Figure 6A).Quantitatively, florescence intensity of Ang II treated arches was twofold greater than that of the control group(Figure 6B)AB Control Ang II972185206375-311785192405DAPIROS Relative to Control803275202565-1275715285115-335280317500**DHEAng IICtrl-1261110373380MERGE-33972598425Figure 6: Ang II induces ROS generation in rat aortic arches after 72 hrs incubation. (A) Representative images of DHE stained aortic arch sections in treated and control groups. (B) Quantification of florescence intensity of ROS generation normalized to DAPI level compared to control. Data are shown as mean +/-SEM. Significance is represented as ** for p<0.01. Images were taken at 40X.3.Ang II treatment for 72 hrs induce VSMC trans-differentiation into osteo/chondrocyte like cellsIn order to determine whether Ang II treatment for 72 hrs induce VSMC trans-differentiation and whether these cells are able to trans-differentiate into osteo/chondrocyte like cells in rat aortic arches, the mRNA level of different osteogenic biomarkers was assessed by q-RT-PCR. The results obtained show that Ang II incubation triggers a significant increase in the transcription level of Ostepontin (Opn) (figure 7A) and Osteocalcin (Ocn) (figure 7B) in treated groups compared to control.AOpn / 18S*P=0.0268CtrlAng II.Ang IICtrlOcn/ 18S*P=0.0317BFigure 7: Trandifferentiation of arterial arch cells into osteo/chondrocyte like cells. mRNA level of different markers: Opn and Ocn was assessed by q-RT-PCR in control and treated groups. 18S housekeeping gene was used for normalization. Results are represented as fold change. Values reported represent average +/- SEM. * indicates a statistical significance with p<0.05.4. Ang II induce inflammation in rat aortic arches after 72 hrs incubationIn order to determine the mRNA level of inflammatory cytokines Il-6 and TNF qRT-PCR was performed. Figure 8A show that Ang II treatment induces a significant elevation in TNF mRNA level in treated groups compared to control ones. However, the increase in Il-6 transcription level in treated groups versus untreated ones was not significant suggesting a correlation that needs better experimental setup to be validated(Figure 8B).A*P=0.0317TNF-?/ 18SAng IICtrlBAng IICtrlIl-6/ 18SFigure 8: Ang II induces inflammation in rat aortic arches after 72 hrs incubation. mRNA level of inflammatory cytokines TNF (A) and Il-6 (B)was assessed by q-RT-PCR in control and treated groups. Results are represented as fold change. Values reported represent mean +/- SEM. * indicates a statistical significance with p<0.05.5. Ang II incubation for 72 hrs enhance PLD1 activity To investigate signaling pathways stimulated upon Ang II treatment, Pld1 mRNA level was assessed as a signaling molecule acting downstream Ang II by qRT-PCR. Data below show a non significant increase in Pld1 transcriptional level in treated groups compared to untreated ones.Ang IICtrlPld1/ 18SPLD1Figure 9: Ang II induces PLD1 expression in rat aortic arches after 72 hrs incubation. mRNA level of signaling molecule Pld1 was assessed by q-RT-PCR in control and treated groups. Results are represented as fold change. Values reported represent mean +/- SEM. Chapter IV: Discussion and Conclusion: VSMC trans-differentiation into osteo/chondrocyte like cells plays a crucial role in promoting VCADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1210/er.2003-0015”, “ISBN” : “0163-769X (Print)”, “ISSN” : “0163769X”, “PMID” : “15294885”, “abstract” : “Pathologists have recognized arterial calcification for over a century. Recent years have witnessed a strong resurgence of interest in atherosclerotic plaque calcification because it: 1) can be easily detected noninvasively; 2) closely correlates with the amount of atherosclerotic plaque; 3) serves as a surrogate measure for atherosclerosis, allowing preclinical detection of the disease; and 4) is associated with heightened risk of adverse cardiovascular events. There are two major types of calcification in arteries: calcification of the media tunica layer (sometimes called Mu00f6nckeberg’s sclerosis), and calcification within subdomains of atherosclerotic plaque within the intimal layer of the artery. There are important similarities and differences between these two entities. Of particular interest are increasing parallels between cellular and molecular features of arterial calcification and bone biology, and this has led to accelerating interest in understanding how and why bone-like mineral deposits may form in arteries. Here, we review the two major pathological types of arterial calcification, the proposed models of calcification, and endocrine and genetic determinants that affect arterial calcification. In addition, we highlight areas requiring further investigation.”, “author” : { “dropping-particle” : “”, “family” : “Doherty”, “given” : “Terence M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fitzpatrick”, “given” : “Lorraine A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Inoue”, “given” : “Daisuke”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Qiao”, “given” : “Jian Hua”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fishbein”, “given” : “Michael C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Detrano”, “given” : “Robert C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Shah”, “given” : “Prediman K.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rajavashisth”, “given” : “Tripathi B.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Endocrine Reviews”, “id” : “ITEM-1”, “issue” : “4”, “issued” : { “date-parts” : “2004” }, “page” : “629-672”, “title” : “Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification”, “type” : “article”, “volume” : “25” }, “uris” : “http://www.mendeley.com/documents/?uuid=a9b6d01d-e6ad-4aea-8655-072928f7d6b3” } , “mendeley” : { “formattedCitation” : “4”, “plainTextFormattedCitation” : “4”, “previouslyFormattedCitation” : “4” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }4. Among the multiple factor involved, Ang II is considered to be critical as alterations in RAAS are present in nearly all cardiovascular diseases. Using a rodent ex vivo hypertension model that mimics hypertension induced arterial calcification in CKD, we demonstrate that Ang II treated aortic arches were capable of mineralization in association with an increase in osteogenic biomarkers. Among the biomarkers studied, OPN and OCN were significantly elevated compared to control group following 72 hrs incubation with Ang II. OPN level of expression increase dramatically in diseases such as hypertension, atherosclerosis, and vascular injury as Ang II induced OPN is associated with heart failure and atherosclerosis. As mentioned previously, OPN is produced by variety of cell types such as macrophages, osteoblast and VSMC however it’s not typically present in blood vessels or released in arterial wallADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/01.HYP.0000128621.68160.dd”, “ISBN” : “1524-4563 (Electronic)
0194-911X (Linking)”, “ISSN” : “0194911X”, “PMID” : “15123578”, “abstract” : “Osteopontin (OPN) is upregulated in several experimental models of cardiac fibrosis and remodeling. However, its direct effects remain unclear. We examined the hypothesis that OPN is important for the development of cardiac fibrosis and remodeling. Moreover, we examined whether the inhibitory effect of eplerenone (Ep), a novel aldosterone receptor antagonist, was mediated through the inhibition of OPN expression against cardiac fibrosis and remodeling. Wild-type (WT) and OPN-deficient mice were treated with angiotensin II (Ang II) for 4 weeks. WT mice receiving Ang II were divided into 2 groups: a control group and an Ep treatment group. Ang II treatment significantly elevated blood pressure and caused cardiac hypertrophy and fibrosis in WT mice. Ep treatment and OPN deficiency could reduce the Ang II-induced elevation of blood pressure and ameliorate the development of cardiac fibrosis, whereas Ep-only treatment abolished the development of cardiac hypertrophy. Most compelling, the reduction of cardiac fibrosis led to an impairment of cardiac systolic function and subsequent left ventricular dilatation in Ang II-treated OPN-deficient mice. These results suggest that OPN has a pivotal role in the development of Ang II-induced cardiac fibrosis and remodeling. Moreover, the effect of Ep on the prevention of cardiac fibrosis, but not cardiac hypertrophy, might be partially mediated through the inhibition of OPN expression.”, “author” : { “dropping-particle” : “”, “family” : “Matsui”, “given” : “Yutaka”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Jia”, “given” : “Nan”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Okamoto”, “given” : “Hiroshi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kon”, “given” : “Shigeyuki”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Onozuka”, “given” : “Hisao”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Akino”, “given” : “Masatoshi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Liu”, “given” : “Lizhi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Morimoto”, “given” : “Junko”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rittling”, “given” : “Susan R.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Denhardt”, “given” : “David”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kitabatake”, “given” : “Akira”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Uede”, “given” : “Toshimitsu”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Hypertension”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2004” }, “page” : “1195-1201”, “title” : “Role of osteopontin in cardiac fibrosis and remodeling in angiotensin II-induced cardiac hypertrophy”, “type” : “article-journal”, “volume” : “43” }, “uris” : “http://www.mendeley.com/documents/?uuid=c4c6f9be-5452-42eb-9501-8831849c907f” } , “mendeley” : { “formattedCitation” : “59”, “plainTextFormattedCitation” : “59”, “previouslyFormattedCitation” : “59” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }59. Supporting our results, in an in vitro study, rat VSMC treated with Ang II (100nM), induce OPN expression starting from 4hr incubation and reaches its peak at 8-12hrs. These results were further approved by the addition of AT1R blocker valsartan where it completely inhibits the mRNA and protein level of OPNADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1291/hypres.31.987”, “ISSN” : “0916-9636”, “PMID” : “18712054”, “abstract” : “Recent studies suggest that osteopontin (OPN) plays a critical role in the progression of atherosclerotic plaques and that angiotensin II (Ang II) is a potent upregulator of OPN expression. The goal of the present study was to characterize the signaling mechanisms whereby Ang II increases OPN expression in vascular smooth muscle cells (VSMC). YM-254890, a specific inhibitor of Gq/11, potently suppressed Ang IIu2013induced OPN expression and ERK1/2 activation. Among dominant-negative (DN) mutants of small G proteins, only DN-Ras suppressed Ang IIu2013induced OPN promoter activity. DN-MEK1 markedly inhibited Ang IIu2013induced OPN promoter activity, while neither DN-JNK nor DN-p38 MAP kinase had any effect. DN-Src and DN-Fyn suppressed Ang IIu2013induced OPN promoter activity. YM-254890 inhibited Ang IIu2013induced Src and Ras activa-tion, and PP2, a selective inhibitor for the Src kinase family, inhibited Ras activation, suggesting that the Gq/11-Src-Ras axis is the upstream signaling cascade for Ang IIu2013induced OPN expression. Finally, small inter-fering RNA against Ets-1 suppressed Ang IIu2013induced OPN expression. In conclusion, these data suggest that Ang IIu2013induced OPN expression in VSMC is mediated by signaling cascades involving Gq/11, the Ras-ERK axis, and the Src kinase family, and by the transcription factor, Ets-1. These signaling molecules may represent therapeutic targets for the prevention of pathological vascular remodeling. (Hypertens Res 2008; 31: 987u2013998)”, “author” : { “dropping-particle” : “”, “family” : “Abe”, “given” : “Keiko”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nakashima”, “given” : “Hidekatsu”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Ishida”, “given” : “Mari”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Miho”, “given” : “Narimasa”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Sawano”, “given” : “Mariko”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Soe”, “given” : “Nwe Nwe”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kurabayashi”, “given” : “Masahiko”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Chayama”, “given” : “Kazuaki”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Yoshizumi”, “given” : “Masao”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Ishida”, “given” : “Takafumi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Hypertens Res”, “id” : “ITEM-1”, “issue” : “5”, “issued” : { “date-parts” : “2008” }, “page” : “987-998”, “title” : “Angiotensin IIu2013Induced Osteopontin Expression in Vascular Smooth Muscle Cells Involves G q/11 , Ras, ERK, Src and Ets-1”, “type” : “article-journal”, “volume” : “31” }, “uris” : “http://www.mendeley.com/documents/?uuid=7cada484-6e83-4b38-8e57-0ff9bcf9d939” } , “mendeley” : { “formattedCitation” : “60”, “plainTextFormattedCitation” : “60”, “previouslyFormattedCitation” : “60” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }60. OCN has putative role in vascular calcification and atherosclerosis. It is not expressed only in the bone but also in VSMC of osteogenic phenotypeADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3389/fendo.2017.00183”, “ISSN” : “16642392”, “abstract” : “Background: Osteocalcin (OC) is an intriguing hormone, concomitantly being the most abundant non-collagenous peptide found in the mineralized matrix of bone, and expanding the endocrine function of the skeleton with far-reaching extra-osseous effects. A new line of enquiry between OC and vascular calcification has emerged in response to observations that the mechanism of vascular calcification resembles that of bone mineralisation. To date, studies have reported mixed results. This systematic review and meta-analysis aimed to identify any association between OC and vascular calcification and atherosclerosis. Methods and results: Databases were searched for original, peer reviewed human studies. A total of 1,453 articles were retrieved, of which 46 met the eligibility criteria. Overall 26 positive, 17 negative, and 29 neutral relationships were reported for assessments between OC (either concentration in blood, presence of OC-positive cells, or histological staining for OC) and extent of calcification or atherosclerosis. Studies that measured OC-positive cells or histological staining for OC reported positive relationships (11 studies). A higher percentage of Asian studies found a negative relationship (36%) in contrast to European studies (6%). Studies examining carboxylated and undercarboxylated forms of OC in the blood failed to report consistent results. The meta-analysis found no significant difference between OC concentration in the blood between patients with “atherosclerosis” and control (p = 0.13, n = 1,197). Conclusion: No definitive association was determined between OC and vascular calcification or atherosclerosis; however, the presence of OC-positive cells and histological staining had a consistent positive correlation with calcification or atherosclerosis. The review highlighted several themes, which may influence OC within differing populations leading to inconclusive results. Large, longitudinal studies are required to further current understanding of the clinical relevance of OC in vascular calcification and atherosclerosis. Copyright u00a9 2017 Millar, Patel, Anderson, England and O’Sullivan.”, “author” : { “dropping-particle” : “”, “family” : “Millar”, “given” : “Sophie A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Patel”, “given” : “Hinal”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Anderson”, “given” : “Susan I.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “England”, “given” : “Timothy J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “O’Sullivan”, “given” : “Saoirse E.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Endocrinology”, “id” : “ITEM-1”, “issue” : “JUL”, “issued” : { “date-parts” : “2017” }, “title” : “Osteocalcin, vascular calcification, and atherosclerosis: A systematic review and meta-analysis”, “type” : “article”, “volume” : “8” }, “uris” : “http://www.mendeley.com/documents/?uuid=01e31974-d389-4d52-b9e7-f8be209da521” } , “mendeley” : { “formattedCitation” : “61”, “plainTextFormattedCitation” : “61”, “previouslyFormattedCitation” : “61” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }61. TGF-? stimulated endothelial cells undergo a mesenchymal stem cell transit and gain the potency to differentiate into osteo/chondrogenic phenotype concomitant with an increase in OCN. In a preclinical model of atherosclerosis where VC occur in a late stage, calcified areas exhibit an increase in the osteocytes specific marker OCN compared to atherosclerotic group receiving Ang receptor type I blocker (ARB) olmesartan medoxomil. In contrast, numerous studies demonstrated that atherosclerotic patients show no significant overall difference in OCN concentration compared to control group ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.3389/fendo.2017.00183”, “ISSN” : “16642392”, “abstract” : “Background: Osteocalcin (OC) is an intriguing hormone, concomitantly being the most abundant non-collagenous peptide found in the mineralized matrix of bone, and expanding the endocrine function of the skeleton with far-reaching extra-osseous effects. A new line of enquiry between OC and vascular calcification has emerged in response to observations that the mechanism of vascular calcification resembles that of bone mineralisation. To date, studies have reported mixed results. This systematic review and meta-analysis aimed to identify any association between OC and vascular calcification and atherosclerosis. Methods and results: Databases were searched for original, peer reviewed human studies. A total of 1,453 articles were retrieved, of which 46 met the eligibility criteria. Overall 26 positive, 17 negative, and 29 neutral relationships were reported for assessments between OC (either concentration in blood, presence of OC-positive cells, or histological staining for OC) and extent of calcification or atherosclerosis. Studies that measured OC-positive cells or histological staining for OC reported positive relationships (11 studies). A higher percentage of Asian studies found a negative relationship (36%) in contrast to European studies (6%). Studies examining carboxylated and undercarboxylated forms of OC in the blood failed to report consistent results. The meta-analysis found no significant difference between OC concentration in the blood between patients with “atherosclerosis” and control (p = 0.13, n = 1,197). Conclusion: No definitive association was determined between OC and vascular calcification or atherosclerosis; however, the presence of OC-positive cells and histological staining had a consistent positive correlation with calcification or atherosclerosis. The review highlighted several themes, which may influence OC within differing populations leading to inconclusive results. Large, longitudinal studies are required to further current understanding of the clinical relevance of OC in vascular calcification and atherosclerosis. Copyright u00a9 2017 Millar, Patel, Anderson, England and O’Sullivan.”, “author” : { “dropping-particle” : “”, “family” : “Millar”, “given” : “Sophie A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Patel”, “given” : “Hinal”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Anderson”, “given” : “Susan I.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “England”, “given” : “Timothy J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “O’Sullivan”, “given” : “Saoirse E.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Frontiers in Endocrinology”, “id” : “ITEM-1”, “issue” : “JUL”, “issued” : { “date-parts” : “2017” }, “title” : “Osteocalcin, vascular calcification, and atherosclerosis: A systematic review and meta-analysis”, “type” : “article”, “volume” : “8” }, “uris” : “http://www.mendeley.com/documents/?uuid=01e31974-d389-4d52-b9e7-f8be209da521” } , “mendeley” : { “formattedCitation” : “61”, “plainTextFormattedCitation” : “61”, “previouslyFormattedCitation” : “61” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }61. Oxidative stress and subsequent inflammation are directly linked to VC, so it was important to check the level of expression of their markers. Growing evidence suggests that Ang II induces its pleiotropic vascular effects via NADPH driven ROS generation. ROS as markers of oxidative stress and inflammation contribute to accelerated vascular damage in hypertension and various diseases. Supporting our results, where Ang II induces significant increase in ROS generation and TNF-? expression; in vitro treatment of VSMC with Ang II for 4-6 hrs, enhance ROS production. These effects are .mediated by the non-phagocytic NADPH oxidase activation as flavoprotein inhibitor attenuates this response in vascular cellsADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1172/JCI118623”, “ISBN” : “0021-9738 (Print)”, “ISSN” : “00219738”, “PMID” : “8621776”, “abstract” : “We tested the hypothesis that angiotensin II-induced hypertension is associated with an increase in vascular .O2- production, and characterized the oxidase involved in this process. Infusion of angiotensin II (0.7 mg/kg per d) increased systolic blood pressure and doubled vascular .O2- production (assessed by lucigenin chemiluminescence), predominantly from the vascular media. NE infusion (2.75 mg/kg per d) produced a similar degree of hypertension, but did not increase vascular .O2- production. Studies using various enzyme inhibitors and vascular homogenates suggested that the predominant source of .O2- activated by angiotensin II infusion is an NADH/NADPH-dependent, membrane-bound oxidase. Angiotensin II-, but not NE-, induced hypertension was associated with impaired relaxations to acetylcholine, the calcium ionophore A23187, and nitroglycerin. These relaxations were variably corrected by treatment of vessels with liposome-encapsulated superoxide dismutase. When Losartan was administered concomitantly with angiotensin II, vascular .O2- production and relaxations were normalized, demonstrating a role for the angiotensin type-1 receptor in these processes. We conclude that forms of hypertension associated with elevated circulating levels of angiotensin II may have unique vascular effects not shared by other forms of hypertension because they increase vascular smooth muscle .O2- production via NADH/NADPH oxidase activation.”, “author” : { “dropping-particle” : “”, “family” : “Rajagopalan”, “given” : “Sanjay”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kurz”, “given” : “Sabine”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Mu00fcnzel”, “given” : “Thomas”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Tarpey”, “given” : “Margaret”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Freeman”, “given” : “Bruce A.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Griendling”, “given” : “Kathy K.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Harrison”, “given” : “David G.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of Clinical Investigation”, “id” : “ITEM-1”, “issue” : “8”, “issued” : { “date-parts” : “1996” }, “page” : “1916-1923”, “title” : “Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation: Contribution to alterations of vasomotor tone”, “type” : “article-journal”, “volume” : “97” }, “uris” : “http://www.mendeley.com/documents/?uuid=feccb26d-e054-45bd-a09f-23fd8d13e245” } , “mendeley” : { “formattedCitation” : “62”, “plainTextFormattedCitation” : “62”, “previouslyFormattedCitation” : “62” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }62. Angiotensin II stimulates NADPH oxidase activity and increase the expression of its subunit in cultured VSMC and intact arteriesADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s11906-014-0431-2”, “ISBN” : “1534-3111”, “ISSN” : “15343111”, “PMID” : “24760441”, “abstract” : “Vascular injury, characterized by endothelial dysfunction, structural remodelling, inflammation and fibrosis, plays an important role in cardiovascular diseases. Cellular processes underlying this include altered vascular smooth muscle cell (VSMC) growth/apoptosis, fibrosis, increased contractility and vascular calcification. Associated with these events is VSMC differentiation and phenotypic switching from a contractile to a proliferative/secretory phenotype. Inflammation, associated with macrophage infiltration and increased expression of redox-sensitive pro-inflammatory genes, also contributes to vascular remodelling. Among the many factors involved in vascular injury is Ang II. Ang II, previously thought to be the sole biologically active downstream peptide of the renin-angiotensin system (RAS), is converted to smaller peptides, Ang III, Ang IV, Ang-(1-7), that are functional and that modulate vascular tone and structure. The actions of Ang II are mediated via signalling pathways activated upon binding to AT1R and AT2R. AT1R activation induces effects through PLC-IP3-DAG, MAP kinases, tyrosine kinases, tyrosine phosphatases and RhoA/Rho kinase. Ang II elicits many of its (patho)physiological actions by stimulating reactive oxygen species (ROS) generation through activation of vascular NAD(P)H oxidase (Nox). ROS in turn influence redox-sensitive signalling molecules. Here we discuss the role of Ang II in vascular injury, focusing on molecular mechanisms and cellular processes. Implications in vascular remodelling, inflammation, calcification and atherosclerosis are highlighted.”, “author” : { “dropping-particle” : “”, “family” : “Montezano”, “given” : “Augusto C.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Nguyen Dinh Cat”, “given” : “Aurelie”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Rios”, “given” : “Francisco J.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Touyz”, “given” : “Rhian M.”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Current Hypertension Reports”, “id” : “ITEM-1”, “issue” : “6”, “issued” : { “date-parts” : “2014” }, “title” : “Angiotensin II and vascular injury”, “type” : “article”, “volume” : “16” }, “uris” : “http://www.mendeley.com/documents/?uuid=0cd9ce1e-0c87-4c16-85fa-eaac8dac828c” } , “mendeley” : { “formattedCitation” : “48”, “plainTextFormattedCitation” : “48”, “previouslyFormattedCitation” : “48” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }48ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1681/ASN.2007020149”, “ISBN” : “2007020149”, “ISSN” : “1046-6673”, “PMID” : “17687073”, “abstract” : “Angiotensin II (AngII) is an important mediator in renal injury. Accumulating evidence suggests that AngII stimulates intracellular formation of reactive oxygen species (ROS) such as the superoxide anion and hydrogen peroxide. AngII activates several subunits of the membrane-bound multicomponent NAD(P)H oxidase and also increases ROS formation in the mitochondria. Some of these effects may be induced by aldosterone and not directly by AngII. The superoxide anion and hydrogen peroxide influence other downstream signaling pathways, such as transcription factors, tyrosine kinases/phosphatases, ion channels, and mitogen-activated protein kinases. Through these signaling pathways, ROS have distinct functional effects on renal cells. They are transducers of cell growth, apoptosis, and cell migration and affect expression of inflammatory and extracellular matrix genes. For example, AngII-mediated expression of p27(Kip1), a cell-cycle regulatory protein, and induction of tubular hypertrophy depend on the generation of ROS. The effects of ROS generated within different renal cells ultimately depend on the locally generated concentrations and the balance of pro- and antioxidant pathways. Although the concept that AngII mediates oxidative stress in the kidney has been validated in experimental models, the exact role is still incompletely understood in human renal diseases.”, “author” : { “dropping-particle” : “”, “family” : “Sachse”, “given” : “Anja”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Wolf”, “given” : “Gunter”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of the American Society of Nephrology : JASN”, “id” : “ITEM-1”, “issue” : “9”, “issued” : { “date-parts” : “2007” }, “page” : “2439-2446”, “title” : “Angiotensin II-induced reactive oxygen species and the kidney.”, “type” : “article-journal”, “volume” : “18” }, “uris” : “http://www.mendeley.com/documents/?uuid=05b3c6db-8e3b-4204-bf72-7a8d814e7c5b” } , “mendeley” : { “formattedCitation” : “63”, “plainTextFormattedCitation” : “63”, “previouslyFormattedCitation” : “63” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }63. TNF-? is a multifunctional cytokine that plays an important role in diverse physiological and pathophysiological processes, such as inflammation, cell survival, growth, differentiation, and apoptosisADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1007/s00395-003-0433-8”, “ISBN” : “0300-8428 (Print)
0300-8428 (Linking)”, “ISSN” : “0300-8428”, “PMID” : “14685702”, “abstract” : “Immune activation plays a significant role in the development and progression of chronic heart failure (CHF). Indeed, pro-inflammatory cytokines, especially tumour necrosis factor-alpha (TNFalpha) are activated in this condition and exert direct detrimental actions on the myocardium. Physiological dampeners of TNFalpha production, such as interleukin-10, catecholamines, cortisol, and others fail in the course of the disease. However, the outcomes of two large-scale clinical trials with etanercept and infliximab, which directly antagonise TNFalpha have been rather disappointing. Nevertheless, TNFalpha antagonism remains a major target of CHF therapy, although counterbalancing this cytokine alone may not be sufficient.”, “author” : { “dropping-particle” : “”, “family” : “Haehling”, “given” : “Stephan”, “non-dropping-particle” : “von”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Jankowska”, “given” : “Ewa a”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Anker”, “given” : “Stefan D”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Basic research in cardiology”, “id” : “ITEM-1”, “issue” : “1”, “issued” : { “date-parts” : “2004” }, “page” : “18-28”, “title” : “Tumour necrosis factor-alpha and the failing heart–pathophysiology and therapeutic implications.”, “type” : “article-journal”, “volume” : “99” }, “uris” : “http://www.mendeley.com/documents/?uuid=fc530928-aa4d-4cb8-ad48-e9c5e038a46d” } , “mendeley” : { “formattedCitation” : “64”, “plainTextFormattedCitation” : “64”, “previouslyFormattedCitation” : “64” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }64. Because inflammation is a key component in the pathogenesis of hypertension and cardiovascular disease, the interaction between Ang II and TNF-? may play an important role in the modulation of hypertensive response. Several in vitro and in vivo studies suggest a crosstalk between Ang II and TNF-a. Consistent with our result, in patients with hypertension or heart failure, chronic blockade of AT1 resulted in a significant decrease in the circulating levels of TNF-?ADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1016/S0735-1097(99)00594-X”, “ISSN” : “07351097”, “PMID” : “10716475”, “abstract” : “Objectives: To evaluate the effects of an angiotensin (Ang II) type 1 receptor antagonist on immune markers in patients with congestive heart failure (CHF). Background: Ang II stimulates production of immune factors via the Ang II type 1 receptor in vitro, and the long-term effects of Ang II type 1 receptor antagonists on plasma markers of immune activation are unknown in patients with CHF. Methods: Twenty-three patients with mild to moderate CHF with left ventricular dysfunction were randomly divided into two groups: treatment with Ang II type 1 receptor (candesartan cilexetil) (n = 14) or placebo (n = 9). We measured plasma levels of immune factors such as tumor necrosis factor alpha (TNFalpha), interleukin-6 (IL-6), soluble intercellular adhesion molecule-1 (sICAM-1) and soluble vascular cell adhesion molecule-1 (sVCAM-1). We also measured plasma levels of the neurohumoral factors such as atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) and cyclic guanosine monophosphate (cGMP), a biological marker of ANP and BNP. Results: Plasma levels of TNFalpha, IL-6, sICAM-1 and sVCAM-1 were increased in the 23 CHF patients compared with normal subjects and significantly decreased after 14 weeks of candesartan cilexetil treatment, but did not change in the placebo group. Plasma levels of BNP, which is a marker of ventricular injury, significantly decreased, and the molar ratio of plasma cGMP to cardiac natriuretic peptides (ANP + BNP) was significantly increased after candesartan cilexetil treatment, but did not change in the placebo group. Conclusions: These findings suggest that 14 weeks of treatment with an Ang II type 1 receptor antagonist (candesartan cilexetil) decreased plasma levels of the immune markers such as TNFalpha, IL-6, sICAM-1 and sVCAM-1 and that it improved the biological compensatory action of endogenous cardiac natriuretic peptides in patients with mild to moderate CHF. (C) 2000 by the American College of Cardiology.”, “author” : { “dropping-particle” : “”, “family” : “Tsutamoto”, “given” : “Takayoshi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Wada”, “given” : “Atsuyuki”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Maeda”, “given” : “Keiko”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Mabuchi”, “given” : “Naoko”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Hayashi”, “given” : “Masaru”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Tsutsui”, “given” : “Takashi”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Ohnishi”, “given” : “Masato”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Sawaki”, “given” : “Masahide”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Fujii”, “given” : “Masanori”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Matsumoto”, “given” : “Takehiro”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Kinoshita”, “given” : “Masahiko”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Journal of the American College of Cardiology”, “id” : “ITEM-1”, “issue” : “3”, “issued” : { “date-parts” : “2000” }, “page” : “714-721”, “title” : “Angiotensin II type 1 receptor antagonist decreases plasma levels of tumor necrosis factor alpha, interleukin-6 and soluble adhesion molecules in patients with chronic heart failure”, “type” : “article-journal”, “volume” : “35” }, “uris” : “http://www.mendeley.com/documents/?uuid=a85c1651-9947-4ea3-a3a2-d9b6046d058a” } , “mendeley” : { “formattedCitation” : “65”, “plainTextFormattedCitation” : “65”, “previouslyFormattedCitation” : “65” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }65. In addition, Ang II treatment induces the production of TNF-? in cultured cardiomyocytes and fibroblastsADDIN CSL_CITATION { “citationItems” : { “id” : “ITEM-1”, “itemData” : { “DOI” : “10.1161/01.RES.85.3.272”, “ISSN” : “0009-7330”, “PMID” : “10436170”, “abstract” : “Angiotensin II (Ang II) plays an important role in post-myocardial infarction (MI) remodeling. Most Ang II effects related to remodeling involve activation of the type 1 receptor (AT(1)). Although the AT(1) receptor is upregulated on cardiac fibroblasts post-MI, little is known about the mechanisms involved in the process. Consequently, we tested whether growth factors known to be present in the remodeling heart increased AT(1) mRNA levels. Using quantitative competitive reverse transcription-polymerase chain reaction, we found that norepinephrine, endothelin, atrial natriuretic peptide, and bradykinin had no significant effect on AT(1) mRNA levels. Ang II, transforming growth factor-beta(1), and basic fibroblast growth factor reduced AT(1) mRNA levels (P<0.02). Tumor necrosis factor-alpha (TNF-alpha), however, produced a marked increase in AT(1) mRNA. After 24 hours of TNF-alpha incubation, AT(1) mRNA increased by 5-fold above control levels (P<0.01). The EC(50) for the TNF-alpha effect was 4.6 ng/mL (0.2 nmol/L). Interleukin (IL)-1beta caused a 2.4-fold increase, whereas IL-2 and IL-6 had no significant effect. Studies of TNF-alpha enhancement of AT(1) mRNA levels demonstrate that the increase was not due to a change in transcript stability. TNF-alpha treatment for 48 hours also resulted in a 3-fold increase in AT(1) surface receptor and a 2-fold increase in Ang II-induced production of inositol phosphates. The present findings provide evidence for TNF-alpha regulation of AT(1) receptor density on cardiac fibroblasts. Because TNF-alpha concentration and AT(1) receptor density increase in the myocardium after MI, these results raise the possibility that TNF-alpha modulates post-MI remodeling by enhancing Ang II effects on cardiac fibroblasts.”, “author” : { “dropping-particle” : “”, “family” : “Gurantz”, “given” : “D”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Cowling”, “given” : “R T”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Villarreal”, “given” : “F J”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” }, { “dropping-particle” : “”, “family” : “Greenberg”, “given” : “B H”, “non-dropping-particle” : “”, “parse-names” : false, “suffix” : “” } , “container-title” : “Circulation research”, “id” : “ITEM-1”, “issue” : “3”, “issued” : { “date-parts” : “1999” }, “page” : “272-279”, “title” : “Tumor necrosis factor-alpha upregulates angiotensin II type 1 receptors on cardiac fibroblasts.”, “type” : “article-journal”, “volume” : “85” }, “uris” : “http://www.mendeley.com/documents/?uuid=e845fa4f-fd5b-4ebd-9e1f-a75db3d7b6e1” } , “mendeley” : { “formattedCitation” : “66”, “plainTextFormattedCitation” : “66” }, “properties” : { “noteIndex” : 0 }, “schema” : “https://github.com/citation-style-language/schema/raw/master/csl-citation.json” }66.Vascular calcification is an active and highly regulated process that involves VSMC trans-differentiation into osteo/chondrocyte like-cells that release MVs. Imbalance of calcification promoters (Runx 2, AGEs) and inhibitors (pyrophosphate, MGP) together with inflammation are critical for its development. These events are influenced by Ang II, where now it is not considered as a simple vasoconstrictor rather a complex growth factor that mediates its effects through multiple signaling pathways, oxidative stress, Nox-derived ROS generation, activation of redox sensitive transcription factors, and upregulation of osteogenic proteins. Targeting some of these molecular events in addition to RAAS inhibitors may protect from vascular injury associated with calcification and promote vascular health.Chapter V: Future perspectives:Based on our results:Ang II induced VC must be confirmed by increasing the n number of samples and check the mRNA and protein level of important mediators in calcification process including transcription factors: Runx2 and Osterix, matrix components: collagen type I, inflammatory cytokines: IL-6 and Il-1, signaling molecules such as PLD2 and smooth muscle 22 ? (SM22?) to ensure VSMC dedifferentiation. Following that, statins, the class of drugs with lipid lowering effects and anti-inflammatory roles; will be added simultaneously with Ang II as drugs affecting RAAS by decreasing ATIR and inhibiting Ang II activated signaling pathways and oxidative stress and VC regression will be monitored. Then inhibiting autophagy to determine whether it is one of the mechanisms induced by statins mediated inhibition of VC and to classify its role in VC if it is inducible or protective.References:ADDIN Mendeley Bibliography CSL_BIBLIOGRAPHY 1A. Avogaro and G. P. Fadini, “Mechanisms of ectopic calcification: implications for diabetic vasculopathy.,” Cardiovasc. Diagn. Ther., vol. 5, no. 5, pp. 343–52, 2015.2B. J. Van Varik, R. J. M. W. Rennenberg, C. P. Reutelingsperger, A. A. Kroon, P. W. De Leeuw, and L. J. Schurgers, “Mechanisms of arterial remodeling: Lessons from genetic diseases,” Frontiers in Genetics, vol. 3, no. DEC. 2012.3T. Kirsch, “Determinants of pathological mineralization,” Current Opinion in Rheumatology, vol. 18, no. 2. pp. 174–180, 2006.4T. M. Doherty et al., “Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification,” Endocrine Reviews, vol. 25, no. 4. pp. 629–672, 2004.5B. Thompson and D. a. Towler, “Arterial calcification and bone physiology: role of the bone–vascular axis,” Nat. Rev. Endocrinol., vol. 8, no. 9, pp. 529–543, 2012.6J. A. Leopold, “Vascular calcification an age-old problem of old age,” Circulation, vol. 127, no. 24, pp. 2380–2382, 2013.7M. Al Hariri et al., “Cigarette smoking-induced cardiac hypertrophy, vascular inflammation and injury are attenuated by antioxidant supplementation in an animal model,” Front. Pharmacol., vol. 7, no. NOV, 2016.8W. Karwowski, B. Naumnik, M. Szczepa?ski, and M. My?liwiec, “The mechanism of vascular calcification – a systematic review,” Med. Sci. Monit., vol. 18, no. 1, p. RA1-RA11, 2012.9J. J. Hsu et al., “Role of vitamin D in vascular calcification: bad guy or good guy?,” Am. J. Nephrol., vol. 27, no. 5, pp. 1704–7, 2010.10J. S. Walsh, “Normal bone physiology, remodelling and its hormonal regulation,” Surg. (United Kingdom), vol. 33, no. 1, pp. 1–6, 2015.11B. Clarke, “Normal bone anatomy and physiology.,” Clinical journal of the American Society of Nephrology?: CJASN, vol. 3 Suppl 3. 2008.12A. D. Berendsen and B. R. Olsen, “Bone development,” Bone, vol. 80. pp. 14–18, 2015.13W. J. Boyle, W. S. Simonet, and D. L. Lacey, “Osteoclast differentiation and activation.,” Nature, vol. 423, no. 6937, pp. 337–42, 2003.14E. F. Eriksen, “Cellular mechanisms of bone remodeling,” Rev Endocr Metab Disord, vol. 11, no. 4, pp. 219–227, 2010.15H. Orimo, “The Mechanism of Mineralization and the Role of Alkaline Phosphatase in Health and Disease,” J. Nippon Med. Sch., vol. 77, no. 1, pp. 4–12, 2010.16J. P. Gorski, “Biomineralization of bone: a fresh view of the roles of non-collagenous proteins.,” Front. Biosci. (Landmark Ed., vol. 16, pp. 2598–621, 2011.17R. Tamma, C. Carbone, and S. Colucci, “Bone matrix proteins and mineralization process,” in Imaging of Prosthetic Joints: A Combined Radiological and Clinical Perspective, 2014, pp. 15–25.18R. A. Terkeltaub, “Inorganic pyrophosphate generation and disposition in pathophysiology,” Peritoneal Dialysis International, vol. 27, no. 281. pp. C1–C11, 2001.19B. Houston, A. J. Stewart, and C. Farquharson, “PHOSPHO1 – A novel phosphatase specifically expressed at sites of mineralisation in bone and cartilage,” Bone, vol. 34, no. 4, pp. 629–637, 2004.20S. Pikula, “Membranes and pathophysiological mineralization,” vol. 62, no. 4, pp. 511–517, 2016.21Jensen, Gopalakrishnan, and J. J. Westendorf, “Regulation of Gene Expression in Osteoblasts,” Biofactors, vol. 36, no. 1, pp. 25–32, 2010.22K. M. Sinha and X. Zhou, “Genetic and molecular control of osterix in skeletal formation,” J. Cell. Biochem., vol. 114, no. 5, pp. 975–984, 2013.23K. L. Tyson, J. L. Reynolds, R. McNair, Q. Zhang, P. L. Weissberg, and C. M. Shanahan, “Osteo/chondrocytic transcription factors and their target genes exhibit distinct patterns of expression in human arterial calcification,” Arterioscler. Thromb. Vasc. Biol., vol. 23, no. 3, pp. 489–494, 2003.24C. H. Byon et al., “Oxidative stress induces vascular calcification through modulation of the osteogenic transcription factor Runx2 by AKT signaling,” J. Biol. Chem., vol. 283, no. 22, pp. 15319–15327, 2008.25M. E. Lin, T. Chen, E. M. Leaf, M. Y. Speer, and C. M. Giachelli, “Runx2 Expression in Smooth Muscle Cells Is Required for Arterial Medial Calcification in Mice,” Am. J. Pathol., vol. 185, no. 7, pp. 1958–1969, 2015.26M. Mazzali, “Osteopontin–a molecule for all seasons,” QJM, vol. 95, no. 1, pp. 3–13, 2002.27M. Scatena, L. Liaw, and C. M. Giachelli, “Osteopontin: A multifunctional molecule regulating chronic inflammation and vascular disease,” Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 27, no. 11. pp. 2302–2309, 2007.28P. Ducy et al., “Increased bone formation in osteocalcin-deficient mice,” Nature, vol. 382, no. 6590, pp. 448–452, 1996.29R. Wallin, D. Cain, S. M. Hutson, D. C. Sane, and R. Loeser, “Modulation of the binding of matrix Gla protein (MGP) to bone morphogenetic protein-2 (BMP-2).,” Thromb. Haemost., vol. 84, no. 6, pp. 1039–44, 2000.30P. a Price, S. a Faus, and M. K. Williamson, “Warfarin causes rapid calcification of the elastic lamellae in rat arteries and heart valves.,” Arterioscler. Thromb. Vasc. Biol., vol. 18, no. 9, pp. 1400–1407, 1998.31S. Liabeuf et al., “Vascular calcification in patients with type 2 diabetes: the involvement of matrix Gla protein.,” Cardiovasc. Diabetol., vol. 13, no. 1, p. 85, 2014.32E. L. Ritman and A. Lerman, “The dynamic vasa vasorum,” Cardiovascular Research, vol. 75, no. 4. pp. 649–658, 2007.33A. Rudijanto, “The role of vascular smooth muscle cells on the pathogenesis of atherosclerosis.,” Acta Med. Indones., vol. 39, no. 2, pp. 86–93, 2007.34E. R. Pfaltzgraff and D. M. Bader, “Heterogeneity in vascular smooth muscle cell embryonic origin in relation to adult structure, physiology, and disease,” Developmental Dynamics, vol. 244, no. 3. pp. 410–416, 2015.35G. M. London, “Arterial calcification: cardiovascular function and clinical outcome.,” Nefrologia, vol. 31, no. 6, pp. 644–7, 2011.36M. Roszkowska, A. Strzelecka-Kiliszek, D. Magne, S. Pikula, and L. Bessueille, “Membranes and pathophysiological mineralization.,” Postepy Biochem., vol. 62, no. 4, pp. 511–517, 2016.37T. M. Doherty et al., “Calcification in atherosclerosis: bone biology and chronic inflammation at the arterial crossroads,” Proc Natl Acad Sci U S A, vol. 100, no. 20, pp. 11201–11206, 2003.38S. S. Kalra and C. M. Shanahan, “Vascular calcification and hypertension: Cause and effect,” Ann. Med., vol. 44, no. sup1, pp. S85–S92, 2012.39T. Sonou et al., “Mineral composition of phosphate-induced calcification in a rat aortic tissue culture model,” J. Atheroscler. Thromb., vol. 22, pp. 1197–1206, 2015.40W. Jahnen-Dechent, A. Heiss, C. Schäfer, and M. Ketteler, “Fetuin-A regulation of calcified matrix metabolism,” Circ. Res., vol. 108, no. 12, pp. 1494–1509, 2011.41E. Neven and P. C. D’Haese, “Vascular calcification in chronic renal failure: what have we learned from animal studies?,” Circ. Res., vol. 108, no. 2, pp. 249–64, 2011.42L. A. DiMeglio and E. A. Imel, “Chapter 13 – Calcium and Phosphate: Hormonal Regulation and Metabolism,” in Basic and Applied Bone Biology, 2014, pp. 261–282.43F. Paneni, S. Costantino, and F. Cosentino, “Molecular mechanisms of vascular dysfunction and cardiovascular biomarkers in type 2 diabetes.,” Cardiovasc. Diagn. Ther., vol. 4, no. 4, pp. 324–32, 2014.44K. a Lomashvili, X. Wang, R. Wallin, and W. C. O’Neill, “Matrix Gla protein metabolism in vascular smooth muscle and role in uremic vascular calcification.,” J. Biol. Chem., vol. 286, no. 33, pp. 28715–22, 2011.45M. Jeziorska, C. McCollum, and D. E. Woolley, “Calcification in atherosclerotic plaque of human carotid arteries: associations with mast cells and macrophages,” J. Pathol., vol. 185, no. 1, pp. 10–17, 1998.46Z. B. Armstrong, D. R. Boughner, M. Drangova, and K. A. Rogers, “Angiotensin II type 1 receptor blocker inhibits arterial calcification in a pre-clinical model,” Cardiovasc. Res., vol. 90, no. 1, pp. 165–170, 2011.47R. M. Touyz, “The role of angiotensin II in regulating vascular structural and functional changes in hypertension.,” Curr. Hypertens. Rep., vol. 5, no. 2, pp. 155–164, 2003.48A. C. Montezano, A. Nguyen Dinh Cat, F. J. Rios, and R. M. Touyz, “Angiotensin II and vascular injury,” Current Hypertension Reports, vol. 16, no. 6. 2014.49R. Kumar, V. P. Singh, and K. M. Baker, “The intracellular renin-angiotensin system in the heart,” Current Hypertension Reports, vol. 11, no. 2. pp. 104–110, 2009.50P. K. Mehta and K. K. Griendling, “Angiotensin II cell signaling: physiological and pathological effects in the cardiovascular system,” Am. J. Physiol. – Cell Physiol., vol. 292, no. 1, pp. C82–C97, 2007.51A. Virdis, E. Duranti, and S. Taddei, “Oxidative Stress and Vascular Damage in Hypertension: Role of Angiotensin II,” Int. J. Hypertens., vol. 2011, pp. 1–7, 2011.52R. M. Touyz, “Reactive oxygen species and angiotensin II signaling in vascular cells: implications in cardiovascular disease,” Brazilian J. Med. Biol. Res., vol. 37, no. 8, pp. 1263–1273, 2004.53G. Jia, R. M. Stormont, D. M. Gangahar, and D. K. Agrawal, “Role of matrix Gla protein in angiotensin II-induced exacerbation of vascular calcification.,” Am. J. Physiol. Heart Circ. Physiol., vol. 303, no. 5, pp. H523-32, 2012.54M. Li, P. Wu, J. Shao, Z. Ke, D. Li, and J. Wu, “Losartan Inhibits Vascular Calcification by Suppressing the BMP2 and Runx2 Expression in Rats In Vivo,” Cardiovasc. Toxicol., vol. 16, no. 2, pp. 172–181, 2016.55D. Glick, S. Barth, and K. F. Macleod, “Autophagy?: cellular and molecular mechanisms,” J. Pathol., vol. 221, no. 1, pp. 3–12, 2010.56S. Lavandero, M. Chiong, B. A. Rothermel, and J. A. Hill, “Autophagy in cardiovascular biology,” Journal of Clinical Investigation, vol. 125, no. 1. pp. 55–64, 2015.57P. Jiang and N. Mizushima, “Autophagy and human diseases,” Nat. Publ. Gr., vol. 24, no. 24, pp. 69–7969, 2013.58S. C. Nussenzweig, S. Verma, and T. Finkel, “The role of autophagy in vascular biology,” Circulation Research, vol. 116, no. 3. pp. 480–488, 2015.59Y. Matsui et al., “Role of osteopontin in cardiac fibrosis and remodeling in angiotensin II-induced cardiac hypertrophy,” Hypertension, vol. 43, no. 6, pp. 1195–1201, 2004.60K. Abe et al., “Angiotensin II–Induced Osteopontin Expression in Vascular Smooth Muscle Cells Involves G q/11 , Ras, ERK, Src and Ets-1,” Hypertens Res, vol. 31, no. 5, pp. 987–998, 2008.61S. A. Millar, H. Patel, S. I. Anderson, T. J. England, and S. E. O’Sullivan, “Osteocalcin, vascular calcification, and atherosclerosis: A systematic review and meta-analysis,” Frontiers in Endocrinology, vol. 8, no. JUL. 2017.62S. Rajagopalan et al., “Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation: Contribution to alterations of vasomotor tone,” J. Clin. Invest., vol. 97, no. 8, pp. 1916–1923, 1996.63A. Sachse and G. Wolf, “Angiotensin II-induced reactive oxygen species and the kidney.,” J. Am. Soc. Nephrol., vol. 18, no. 9, pp. 2439–2446, 2007.64S. von Haehling, E. a Jankowska, and S. D. Anker, “Tumour necrosis factor-alpha and the failing heart–pathophysiology and therapeutic implications.,” Basic Res. Cardiol., vol. 99, no. 1, pp. 18–28, 2004.65T. Tsutamoto et al., “Angiotensin II type 1 receptor antagonist decreases plasma levels of tumor necrosis factor alpha, interleukin-6 and soluble adhesion molecules in patients with chronic heart failure,” J. Am. Coll. Cardiol., vol. 35, no. 3, pp. 714–721, 2000.66D. Gurantz, R. T. Cowling, F. J. Villarreal, and B. H. Greenberg, “Tumor necrosis factor-alpha upregulates angiotensin II type 1 receptors on cardiac fibroblasts.,” Circ. Res., vol. 85, no. 3, pp. 272–279, 1999.
